Porfiria cutánea tarda

Genética. Mutación. Gen. Enzima uroporfirinógeno-descarboxilasa. Síndrome dérmico

  • Enviado por: Piccola
  • Idioma: castellano
  • País: España España
  • 6 páginas
publicidad
publicidad

PORFIRIA CUTANEA TARDA (PCT)

Esta enfermedad está causada por mutaciones en el gen que codifica la uroporfirinógeno-descarboxilasa (UROD). Es la cuarta enzima citosólica involucrada en la biosíntesis de hemo. Cataliza cuatro de los sitios carboximetilados de uroporfirinógeno a coproporfirinógeno. Implica 4 decarboxilaciones sucesivas.

El defecto patogénico fundamental reside en una hipoactividad hepática de la enzima uroporfirinógeno-descarboxilasa, transmitida de forma autosómica dominante, lo que origina una acumulación y una excreción incrementada de uroporfirina y de otras porfirinas policarboxílicas, responsables a su vez de los procesos de fotosensibilización.

El estudio de la actividad enzimática en hematíes han permitido tipificar cinco subtipos de porfiria cutánea tarda. En este trabajo vamos a tratas la porfiria cutánea tarda familiar tipo II, donde se describe una actividad y una concentración de UROD eritrocitaria disminuida en un 50% del valor normal. Como es evidente, el término tarda hace referencia a la usualmente tardía edad de comienzo de las manifestaciones clínicas: quinta década de la vida en los varones y cuarta en las mujeres. Los rasgos físicos característicos sobre los que se basa el diagnóstico médico de la enfermedad son:

Síndrome dérmico. Se manifiesta en zonas expuestas a la acción de la luz solar: dorso de las manos, cara, cuello y en las mujeres, en la zona anterior de las piernas y pies. Tras la exposición solar se desarrollan erosiones y ampollas de contenido seroso que al secarse dejan crostas serohemáticas que al desprenderse dejan cicatrices hiperpigmentadas o hipopigmentadas.

Hepatopatías. Además del consumo de alcohol y la propia acumulación de porfirinas en el tejido hepático, casi la mitad de los pacientes evidenciasn positividad de alguno de los marcadores séricos del virus de la hepatitis B.

El locus de la uroporfirinógeno-descarboxilasa está en el brazo corto del cromosoma 1 (1p34). El gen codificante para UROD está formado por 10 exones con una longitud de 4.514Kb, de los que 1.197bp corresponden a nucleótidos que dan lugar al mRNA, lo cual corresponde a una proteína de 367 aminoácidos.

Básicamente se localizó el gen con estudio de clones de cDNA e hibridación in situ. Los primeros experimentos se realizaron en el año 1985. No fue hasta 1998 que se secuencia el gen UROD entero, desarrollando un método de PCR para la amplificación y mayor analisis las posibles mutaciones, con esta misma técnica fueron identificadas cuatro mutaciones sin sentido, una microinserción, una deleción y un defecto de splicing en uno de los exones.

Se han descrito, por el momento, 12 variantes alélicas para esta enfermedad: Gly 281 Val, deleción del exón 6, Glu 314 Glu, Met 165 Arg, Leu 195 Phe, Asn 304 Lys, Arg 332 His, (que dan fenotipo de porfiria cutánea tarda) y Gly 281 Glu, Glu 167 Lys, Arg 292 Gly, Pro 62 Leu, Tyr 311 Cys, (que da una variante denominada porfiria hepatoeritropoietica). En nuestro caso clínico vamos a estudiar una familia afectada por la primera de las variantes alélicas, contenida en el exón 8. Es una mutación con sentido que se expresaría como .g3644 G>A o bien .c861 G>U:

3541 aggccctctg tagcctgaga tctgcttttt tctagatcat ctttgctaag

3591 gatgggcatt ttgccctgga ggagctggcc caagctggct atgaggtggt

3641 tggacttgac tggacagtgg ccccaaagaa agcccggtaa gccatggaag

CASO CLINICO

Una paciente de 35 años de edad en el quinto mes de la gestación con antecedentes familiares de porfiria cutánea tarda tipo II nos pide consejo genético para su futuro hijo. El pedrigrí familiar es el siguiente:

I 1 2

II 1 2 3 4 5 6 7 8

III 1 2 3

Para poder dar consejo genético a este paciente realizaremos un diagnóstico directo, el cual nos permite tipificar los individuos con la mutación. En esta enfermedad debemos tener en cuenta que los síntomas no aparecen hasta la cuarta década de vida en las mujeres, y la quinta en los hombres. En nuestro pedigrí, las edades de los individuos con fenotipo no afectado son: I.2 tiene 72 años, II.1 tiene 54 años, II.4 tiene 52 años, II.5 tiene 35 años, II.6 tiene 40 años, II.7 y II.8 tienen 33 años y III.2 tiene 12 años. De estos datos debemos deducir que los individuos I.2, II.1 y II.4 estarán verdaderamente sanos, y los individuos II.5, II.6, II.7, II.8 y III.2, pueden desarrollar la enfermedad en edades más avanzadas. Todo esto debemos comprobarlo con el método de diagnóstico directo.

Nuestro diagnóstico indirecto se va a basar en amplificar el DNA mediante la técnica del PCR para después someterlo a un SSCP (Single Strand Conformation Polymorphism), que nos permite denaturalizando el DNA para que las cadenas sencillas del ADN adopten distintas conformaciones y corran distintamente en una electroforesis de gel de acrilamida. Hemos descartado el dignóstico indirecto basado en enzimas de restricción. El nucleótido mutado consituye diana de restricción para una enzima (CviJ I) que tiene otras muchas dianas muy cercanas entre sí y con la secuencia mutada, por lo que la poca diferencia de peso molecular de los fragmentos y la gran cantidad de ellos nos van a dificultar mucho el diagnóstico.

El protocolo es el siguiente:

  • Obtención de DNA de los individuos que vamos a genotipar.

  • PCR (amplifiación de la región específica a estudiar, la cual debe contener el punto de mutación)

  • Debemos poner, en un tubo estéril de 0,5 ml, los siguientes reactivos: 1xPCRSupermix, 10 pmols de cada uno de los primers y 100 ng de DNA genómico. A continuación añadimos dos gotas de aceite mineral y ponemos los tubos en el termociclador. Conectamos el programa: 40 seg a 94º, 30 seg a 55º, 40 seg a 72º, repetimos los tres primeros pasos haciendo un total de 28 ciclos, 5 min a 72º y finalmente a 4º.

  • Los primers que vamos a utilizar los hemos obtenido del programa cutter:

  • Primer directo: 5'- GGAGGGCAGCAGAAGTACAG-3'

    Primer indirecto: 5'-CTCACCCTTCCATGGCTTAC-3'

    Esquematizado (primers en azul, mutación en rojo y exón 8 en gris):

    3481 actggagtgaccactggagggcagcagaagtacagtcaagaaagattagtggttgtagca

    3541 aggccctctgtagcctgagatctgcttttttctagatcatctttgctaaggatgggcatt

    3601 ttgccctggaggagctggcccaagctggctatgaggtggttggacttgactggacagtgg

    3661 ccccaaagaaagcccggtaagccatggaagggtgaggccttgaggttgaggtgggggtgt

  • Preparación del gel de acrilamida para el SSCP

  • 3.1 Preparamos 20 ml de la solución de acrilamida en un vaso de precipitado de la siguiente forma: 6 ml de acrilamida-bisacrilamida 40 %, 4 ml de TBE 5x, 1.2 ml de glicerol 85% y 8.8 ml de agua destilada. A esto le añadimos 150 l de persulfato amónico 10% (APS) y 40 l de TEMED.

  • Electroforesis del tipo SSCP

  • 4.1 Preparamos las muestras para la electroforesis: mezclamos 10 l de tampón de carga desnaturalizante con 3l de la reacción de PCR.

    4.2 Cargamos las muestras en el gel, dejando un carril para cargar 3 l de marcador de peso molecular. Conectamos los electrodos e iniciamos la electroforesis a unos 180 V.

  • Tinción de plata del SSCP

  • 5.1 Fijamos el gel con una soluciónde etanol durante 5-10 min

    5.2 Tratamos el gel con una solución de HNO3 durante 3 min

    5.3 Hacemos dos lavados de 20 seg con H2O bidestilada.

    5.4 Teñimos el gel con una solución de AgNO3 durante 20 min

    5.5 Hacemos dos lavados más de 30 seg con H2O destilada.

    5.6 Revelar con una solución de Na2CO3, evitando que éste precipite sobre el gel.

    5.7 Paramos el revelado con una soluciónde ácido cítrico.

  • Visualización de los resultados

  • pesos

    moleculares I.1 I.2 II.1 II.2 II.3 II.4 II.5 II.6 II.7 II.8 III.1 III.2 III.3

    Interpretación de los resultados: Encontramos dos tipos de patrones de bandas. Los individuos como el I.1 son heterocigotos para dicha mutación y presentan cuatro alelos distintos, debido a que el DNA está desnaturalizado: 2 mutados (los superiores) y dos salvajes (los inferiores). Estos individuos van a desarrollar en etapas avanzadas de la vida la enfermedad cuya mutación estamos testando: porfiria cutánea tarda. En el otro grupo de individuos encontramos tan solo dos bandas, esto nos indica que son homocigotos para el alelo sano y por tanto no desarrollarán la enfermedad.

    La paciente por la cual estamos realizando el diagnóstico es heterocigota, esto quiere decir que aunque en la actualidad (tiene 35 años) no tenga fenotipo de afecto, podrá tenerlo cuando entre aproximadamente a la cuarta década de su vida. Ello implica que el hijo que está gestando podría estar afectado si ha heredado el alelo portador de la mutación. Debemos comprobarlo con nuestros resultados y efectivamente el hijo (que en este pedigrí es el individuo III.3) es heterocigoto, portados de la mutación y por tanto enfermo debido al carácter dominante de la misma.

    Consejo genético: La información que deberíamos dar a esta mujer es que su hijo, con toda probabilidad, desarrollará la enfermedad porfiria cutánea tarda. A pesar de los resultados debemos tener en cuenta también que la técnica de SSCP tiene una fiabilidad de aproximadamente un 80 % y aunque nuestros resultados son prácticamoente seguros, podemos ofrecer a la paciente la posibilidad de repetir el diagnóstico con otros métodos: enzimas de restricción, Southern blot,... para verificar lo obtenido. Además podemos predecir que tiene una probabilidad de un 50 % de tener otro hijo enfermo si se vuelve a quedar embarazada.

    Nuestro consejo abarcaría también parte del ámbito médico y además de informarle sobre todos los rasgos que afecta esta enfermedad, podríamos aconsejarle posibles tratamientos tanto preventivos como curativos. Sólo durante la fase clínica o bioquímicamente activa de la enfermedad se recomendará al paciente evitar y protegerse frente a la exposición solar. La mera supresión de los factores desencadenantes (alcohol, estrógenos, hidrocarburos policlorinados) puede inducir la remisión del proceso.

    BIBLIOGRAFIA:

    FARRERA, ROZMAN. Medicina Interna, vol.II. España, Harcourt Brace, 1929; 1884-1885.

    LAGARTERA, L. et al. Aproximación de laboratorio al diagnóstico y tipificación de una porfirina. Anales de medicina interna; Hospital 12 de Octubre, Madrid. 17:11; 609-613, 2000.

    ROMANA, M. Et al. Structure of the gene for human uroporphyrinogen decarboxylase. Nucleic Acids Res. 15: 7343-7356, 1987.

    SASSA, S et al. Purification and properties of human erythrocyte uroporphyrinogen decarboxylase: immunological demonstration of the enzyme defect in porphyria cutanea tarda. Trans. Assoc. Am. Phys. 96: 65-75, 1983.

    DE VERNEUIL, H et al. Assignment of the gene for uroporphyrinogen decarboxylase to human chromosome 1 by somatic cell hybridization and specific enzyme immunoassay. Hum. Genet. 66: 202-205, 1984.

    DUBART, A et al. Assignment of human uroporphyrinogen decarboxylase (URO-D) to the p34 band of chromosome 1. Hum. Genet. 73: 277-279, 1986.