Bioelementos

Oligoelementos. Agua. Glúcidos. Lípidos. Proteínas. Enzimas. Ácidos nucleicos

  • Enviado por: El remitente no desea revelar su nombre
  • Idioma: castellano
  • País: España España
  • 33 páginas

publicidad
cursos destacados
Fundamentos de Termodinámica Clásica
Fundamentos de Termodinámica Clásica
Fundamentos de Termodinámica Clásica es el curso donde resolverás preguntas como...
Ver más información

PREICFES Saber 11 Lectura Crítica Versión 2014
PREICFES Saber 11 Lectura Crítica Versión 2014
NO TE PIERDAS EL MUNDIAL YENDO A UN PREICFES VACACIONAL TRADICIONAL, MEJOR ESTUDIA DESDE TU CELULAR...
Ver más información

publicidad

1.Bioelementos

2.El agua: una extraña molécula

3.Glúcidos

4.Lípidos

Formación de la bicapa lipídica.Gif animado (500 KB)

5.Proteínas

Los 20 Aminoácidos

Enlace peptídico: Gif animado

6.Enzimas

reacción enzimática:animación (90 KB)

7.Ácidos Nucléicos

Estructura del ADN

molécula de ADN.gif

Transferencia de la información

Síntesis de ARN o TRANSCRIPCIÓN

sintesis ARN (fichero de video QT 270 KB)

Síntesis de proteínas o TRADUCCIÓN

sintesis de proteínas (fichero video QT de 400 KB )

Código genético

Regulación de la expresión génica

Actividades de bioquímica

Actividades de genética molecular

1.Organización de la célula eucariota

1.Membrana

Estructura

Fisiología

2.Citoplasma : Citosol y citoesqueleto

Retículo endoplásmico

A. de Golgi

Lisosomas

relación entre retículo , golgi y lisosomas. (gif de

150 KB)

Mitocondrias

Cloroplastos

3.Núcleo

4.Componentes celulares

2.Fisiología celular

1.Funciones de autoconservación

2.Energética celular: Fotosíntesis.

1.Fase luminosa

2.Fase oscura

3.Hipótesis quimiosmótica de la fotofosforilación

4.Importancia biológica de la fotosíntesis

3.Energética celular: Respiración

Glucolisis

gif animado de glucolisis (46 KB)

Ciclo de Krebs

gif animado del ciclo de krebs

Transporte de electrones

síntesis de ATP (fichero video QT de 340 KB )

Hipótesis quimiosmótica

(síntesis de ATP)

El ATP

4.Reproducción celular

El ciclo celular

Mitosis

Meiosis

gif animado de la meiosis

Actividades de citología

1.Funciones de nutrición

2.Reproducción y desarrollo

3.Coordinación neuro-endocrina

4.Genética mendeliana

Conceptos básicos

Leyes de Mendel

Animación de la 3ª Ley de Mendel

Series alélicas

Herencia del sexo

Genes ligados

Mutaciones

1.Cromosómicas

2.Genómicas

3.Génicas

Problemas de genética

1.Herencia de un carácter

2.Herencia de dos caracteres

3.Herencia de alelos múltiples

4.Herencia ligada e influída por el sexo.

MICROBIOLOGÍA E INMUNOLOGÍA

1.Bacterias

2.Virus

3.Priones y "enfermedad de las vacas locas"

4.Inmunología

Actividades de Microbiología

BIOELEMENTS

Los elementos de la vida

Todos los seres vivos están constituidos, cualitativa y cuantitativamente por los mismos elementos químicos. De todos los elementos que se hallan en la corteza terrestre, sólo unos 25 son componentes de los seres vivos . Esto confirma la idea de que la vida se ha desarrollado sobre unos elementos concretos que poseen unas propiedades físico-químicas idóneas acordes con los procesos químicos que se desarrollan en los seres vivos. Se denominan elementos biogénicos o bioelementos a aquellos elementos

químicos que forman parte de los seres vivos. Atendiendo a su abundancia (no importancia) se pueden agrupar en tres categorías:

Bioelementos primarios o principales: C, H, O, N

Son los elementos mayoritarios de la materia viva, constituyen el 95% de la masa total.

Las propiedades físico-químicas que los hacen idóneos son las siguientes

1.Forman entre ellos enlaces covalentes, compartiendo electrones

2.El carbono, nitrógeno y oxígeno, pueden compartir más de un par de electrones, formando enlaces dobles y triples, lo cual les dota de una gran versatilidad para el enlace químico

3.Son los elementos más ligeros con capacidad de formar enlace covalente, por lo que dichos enlaces son muy estables.

4.A causa de la configuración tetraédrica de los enlaces del carbono, los diferentes tipos de moléculas orgánicas tienen estructuras tridimensionales diferentes . Esta conformación espacial es responsable de la actividad biológica.

5.Las combinaciones del carbono con otros elementos, como el oxígeno, el hidrógeno, el nitrógeno, etc., permiten la aparición de una gran variedad de grupos funcionales que dan lugar a las diferentes familias de sustancias orgánicas . Estos presentan características físicas y químicas diferentes, y dan a las moléculas orgánicas propiedades específicas, lo que aumenta las posibilidades de cración de nuevas moléculas orgánicas por reacción entre los diferentes grupos.

6.Los enlaces entre los átomos de carbono pueden ser simples (C - C), dobles (C = C) o triples lo que permite que puedan formarse cadenas más o menos largas, lineales, ramificadas y anillos.

Bioelementos secundarios S, P, Mg, Ca, Na, K, Cl Los encontramos formando parte de todos los seres vivos, y en una proporción del 4,5%.

Azufre: Se encuentra en dos aminoácidos (cisteína y metionina) , presentes en todas las proteínas. También en algunas sustancias como el Coenzima A

Fósforo: Forma parte de los nucleótidos, compuestos que forman los ácidos nucléicos. Forman parte de coenzimas y otras moléculas como fosfolípidos, sustancias fundamentales de las membranas celulares. También forma parte de los fosfatos, sales minerales abundantes en los seres vivos.

Magnesio: Forma parte de la molécula de clorofila, y en forma iónica actúa como catalizador, junto con las enzimas , en muchas reacciones químicas del organismo.

Calcio: Forma parte de los carbonatos de calcio de estructuras esqueléticas. En forma iónica interviene en la contracción muscular, coagulación sanguínea y transmisión del impulso nervioso.

Sodio: Catión abundante en el medio extracelular; necesario para la conducción nerviosa y la contracción muscular.

Potasio: Catión más abundante en el interior de las células; necesario para la conducción nerviosa y la contracción muscular.

Cloro: Anión más frecuente; necesario para mantener el balance de agua en la sangre y fluído intersticial.

Oligoelementos

Se denominan así al conjunto de elementos químicos que están presentes en los organismos en forma vestigial, pero que son indispensables para el desarrollo armónico del organismo. Se han aislado unos 60 oligoelementos en los seres vivos, pero solamente 14 de ellos pueden considerarse comunes para casi todos, y estos son: hierro, manganeso, cobre, zinc, flúor, iodo, boro, silicio, vanadio, cromo, cobalto, elenio, molibdeno y estaño. Las funciones que desempeñan, quedan reflejadas en el siguiente cuadro:

Hierro

Fundamental para la síntesis de clorofila, catalizador en reacciones químicas y formando parte

de citocromos que intervienen en la respiración celular, y en la hemoglobina que interviene en

el transporte de oxígeno.

Manganeso

Interviene en la fotolisis del agua , durante el proceso de fotosíntesis en las plantas.

Iodo

Necesario para la síntesis de la tiroxina, hormona que interviene en el metabolismo

Flúor

Forma parte del esmalte dentario y de los huesos.

Cobalto

Forma parte de la vitamina B12, necesaria para la síntesis de hemoglobina .

Silicio

Proporciona resistencia al tejido conjuntivo, endurece tejidos vegetales como en las

gramíneas.

Cromo

Interviene junto a la insulina en la regulación de glucosa en sangre.

Zinc

Actúa como catalizador en muchas reacciones del organismo.

Litio

Actúa sobre neurotransmisores y la permeabilidad celular. En dosis adecuada puede prevenir

estados de depresiones.

Molibdeno

Forma parte de las enzimas vegetales que actúan en la reducción de los nitratos por parte de

las plantas.

EL AGUA

El agua, una molécula simple y extraña, puede ser considerada como el líquido de la vida. Es la sustancia más abundante en la biosfera, dónde la encontramos en sus tres estados y es además el componente mayoritario de los seres vivos, pues entre el 65 y el 95% del peso de de la mayor parte de las formas vivas es agua. El agua fue además el soporte donde surgió la vida. Molécula con un extraño comportamiento que la convierten en una sustancia diferente a la mayoría de los líquidos, posee una manifiesta reaccinabilidad y posee unas extraordinarias propiedades físicas y químicas que van a ser responsables de su importancia biológica. Durante la evolución de la vida, los organismos se han adaptado al ambiente acuoso y han desarrollado sistemas que les permiten aprovechar las inusitadas propiedades del agua.

Estructura del agua

Propiedades físicoquímicas

1.Acción disolvente

2.Elevada fuerza de cohesión

3.Elevada fuerza de adhesión

4.Gran calor específico

5.Elevado calor de vaporización

Funciones biológicas

1.Ionización del agua

2.Disociación del agua

3.Producto iónico del agua

4.Concepto de pH

5.Sistemas tampón

Ósmosis y fenómenos osmóticos

Las sales minerales

Estructura del agua

La molécula de agua está formada por dos átomos de H unidos a un átomo de O por medio de dos enlaces covalentes. La disposición tetraédrica de los orbitales sp3 del oxígeno determina un ángulo entre los enlaces H-O-H aproximadamente de 104'5º, además el oxígeno es más electronegativo que el hidrógeno y atrae con más fuerza a los electrones de cada enlace. El resultado es que la molécula de agua aunque tiene una carga total neutra (igual número de protones que de electrones ), presenta una distribución asimétrica de sus electrones, lo que la convierte en una molécula polar, alrededor del oxígeno se concentra una densidad de carga negativa , mientras que los núcleos de hidrógeno quedan desnudos, desprovistos parcialmente de sus electrones y manifiestan, por tanto, una densidad de carga positiva. Por eso en la práctica la molécula de agua se comporta como un dipolo. Así se establecen interacciones dipolo-dipolo entre las propias moléculas de agua, formándose enlaces o puentes de hidrógeno, la carga parcial negativa del oxígeno de una molécula ejerce atracción electrostática sobre las cargas parciales positivas de los átomos de hidrógeno de otras moléculas adyacentes. Aunque son uniones débiles, el hecho de que alrededor de cada molécula de agua se dispongan otras cuatro molécula unidas por puentes de hidrógeno permite que se forme en el agua (líquida o sólida) una estructura de tipo reticular, responsable en gran parte de su comportamiento anómalo y de la peculiaridad de sus propiedades físicoquímicas.

Propiedades del agua

1. Acción disolvente

El agua es el líquido que más sustancias disuelve, por eso decimos que es el disolvente universal. Esta propiedad, tal vez la más importante para la vida, se debe a su capacidad para formar puentes de hidrógeno con otras sustancias que pueden presentar grupos polares o con carga iónica ( alcoholes, azúcares con grupos R-OH , aminoácidos y proteínas con grupos que presentan cargas + y - , lo que da lugar a disoluciones moleculares. También las moléculas de agua pueden disolver a sustancias salinas que se disocian formando disoluciones iónicas. En el caso de las disoluciones iónicas (fig.6) los iones de las sales son atraídos por los dipolos del agua, quedando "atrapados" y recubiertos de moléculas de agua en forma de iones hidratados o solvatados. La capacidad disolvente es la responsable de dos funciones :

1.Medio donde ocurren las reacciones del metabolismo

2.Sistemas de transporte

2. Elevada fuerza de cohesión

Los puentes de hidrógeno mantienen las moléculas de agua fuertemente unidas, formando una estructura compacta que la convierte en un líquido casi incomprensible. Al no poder comprimirse puede funcionar en algunos animales como un esqueleto hidrostático, como ocurre en algunos gusanos perforadores capaces de agujerear la roca mediante la presión generada por sus líquidos internos.

3. Elevada fuerza de adhesión

Esta fuerza está también en relación con los puentes de hidrógeno que se establecen entre las moléculas de agua y otras moléculas polares y es responsable, junto con la cohesión del llamado fenómeno de la capilaridad. Cuando se introduce un capilar en un recipiente con agua, ésta asciende por el capilar como si trepase agarrándose por las paredes, hasta alcanzar un nivel superior al del recipiente, donde la presión que ejerce la columna de agua , se equilibra con la presión capilar. A este fenómeno se debe en parte la ascensión de la savia bruta desde las raíces hasta las hojas, a través de los vasos leñosos.

4. Gran calor específico

También esta propiedad está en relación con los puentes de hidrógeno que se forman entre las moléculas de agua. El agua puede absorber grandes cantidades de "calor" que utiliza para romper los p.de h. por lo que la temperatura se eleva muy lentamente. Esto permite que el citoplasma acuoso sirva de protección ante los cambios de temperatura. Así se mantiene la temperatura constante.

5. Elevado calor de vaporización

Sirve el mismo razonamiento, también los p.de h. son los responsables de esta propiedad. Para evaporar el agua , primero hay que romper los puentes y posteriormente dotar a las moléculas de agua de la suficiente energía cinética para pasar de la fase líquida a la gaseosa. Para evaporar un gramo de agua se precisan 540 calorías, a una temperatura de 20º C.

Funciones del agua

Las funciones del agua se relacionan íntimamente con las propiedades anteriormente descritas. Se podrían resumir en los siguientes puntos:

1.Soporte o medio donde ocurren las reacciones metabólicas

2.Amortiguador térmico

3.Transporte de sustancias

4.Lubricante, amortiguadora del roce entre órganos

5.Favorece la circulación y turgencia

6.Da flexibilidad y elasticidad a los tejidos

7.Puede intervenir como reactivo en reacciones del metabolismo, aportando hidrogeniones o hidroxilos al medio.

Ionización del agua

Disociación del agua

El agua pura tiene la capacidad de disociarse en iones, por lo que en realidad se puede considerar una mezcla de :

agua molecular (H2O )

protones hidratados (H3O+ ) e

iones hidroxilo (OH-)

En realidad esta disociación es muy débil en el agua pura, y así el producto iónico del agua a 25º es

Este producto iónico es constante. Como en el agua pura la concentración de hidrogeniones y de hidroxilos es la misma, significa que la concentración de hidrogeniones es de 1 x 10 -7. Para simplificar los cálculos Sorensen ideó expresar dichas concentraciones utilizando logaritmos, y así definió el pH como el logaritmo cambiado de signo de la concentración de hidrogeniones. Según ésto:

disolución neutra pH = 7

disolución ácida pH < 7

disolución básica pH > 7

En general hay que decir que la vida se desarrolla a valores de pH próximos a la neutralidad. Los organismos vivos no soportan variaciones del pH mayores de unas décimas de unidad y por eso han desarrollado a lo largo de la evolución sistemas de tampón o buffer, que mantienen el pH constante mediante mecanismos homeostáticos. Los sistemas tampón consisten en un par ácido-base conjugada que actúan como dador y aceptor de protones respectivamente. El tampón bicarbonato es común en los líquidos intercelulares, mantiene el pH en valores próximos a 7,4, gracias al equilibrio entre el ión bicarbonato y el ácido carbónico, que a su vez se disocia en dióxido de carbono y agua; Si aumenta la concentración de hidrogeniones en el medio por cualquier proceso químico, el equilibrio se desplaza a la derecha y se elimina al exterior el exceso de CO2 producido. Si por el contrario disminuye la concentración de hidrogeniones del medio, el equilibrio se desplaza a la izquierda, para lo cual se toma CO2 del medio exterior.

Ósmosis

1. Ósmosis y presión osmótica

Si tenemos dos disoluciones acuosas de distinta concentración separadas por una membrana semipermeable (deja pasar el disolvente pero no el soluto ), se pruduce el fenómeno de la ósmosis que sería un tipo de difusión pasiva caracterizada por el paso del agua ( disolvente ) a través de la membrana semipermeable desde la solución más diluida ( hipotónica ) a la más concentrada (hipertónica ), este trasiego continuará hasta que las dos soluciones tengan la misma concentración ( isotónicas o isoosmóticas ). Y se entiende por presión osmótica la presión que sería necesaria para detener el flujo de agua a través de la membrana semipermeable. La membrana plasmática de la célula puede considerarse como semipermeable, y por ello las células deben permanecer en equilibrio osmótico con los líquidos que las bañan. Cuando las concentraciones de los fluidos extracelulares e intracelulares es igual , ambas disoluciones son isotónicas. Si los líquidos extracelulares aumentan su concentración de solutos se hacer hipertónicos respecto a la célula, y ésta pierde agua, se deshidrata y mueren (plamólisis). Y si por el contrario los medios extracelulares se diluyen, se hacen hipotónicos respecto a la célula, el agua tiende a entrar y las células se hinchan, se vuelven turgentes ( turgescencia ), llegando incluso a estallar.

2. La difusión y la diálisis

Los líquidos presentes en los organismos son dispersiones de diversas sustancias en el seno del agua. Según el tamaño de las partículas se formarán dispersiones moleculares o disoluciones verdaderas como ocurre con las que se forman con las sales minerales o por sustancias orgánicas de moléculas pequeñas, como los azúcares o aminoácidos. Las partículas dispersas pueden provocar además del movimiento de ósmosis , estos otros dos:

La diálisis. En este caso pueden atravesar la membrana además del disolvente, moléculas de bajo peso molecular y éstas pasan atravesando la membrana desde la solución más concentrada a la más diluida. Es el fundamento de la hemodiálisis que intenta sustituir la filtración renal deteriorada.

La difusión sería el fenómeno por el cual las moléculas disueltas tienden a distribuirse uniformemente en el seno del agua. Puede ocurrir también a través de una membrana si es lo suficientemente permeable. Así se realizan los intercambios de gases y de algunos nutrientes entre la célula y el medio en el que vive.

Sales minerales

Además del agua existe otras biomoléculas inorgánicas como las sales minerales. En función de su solubilidad en agua se distinguen dos tipos: insolubles y solubles en agua.

1.Sales insolubles en agua.

Forman estructuras sólidas, que suelen tener función de sostén o protectora, como:

  • Esqueleto interno de vertebrados, en el que encontramos fosfatos, cloruros, y carbonatos de calcio.

  • Caparazones de carbonato cálcico de crustáceos y moluscos.

  • Endurecimiento de células vegetales, como en gramíneas (impregnación con sílice).

  • Otolitos del oído interno,formados por cristales de carbonato cálcico equilibrio).

2.Sales solubles en agua.

Se encuentran disociadas en sus iones (cationes y aniones ) que son los responsables de su actividad biológica. Desempeñan las siguientes funciones:

  • Funciones catalíticas. Algunos iones, como el Cu+, Mn2+, Mg2+, Zn+,...actúan como cofactores enzimáticos.

  • Funciones osmóticas. Intervienen en los procesos relacionados con la distribución de agua entre el interior celular y el medio donde vive esa célula. Los iones de Na, K, Cl y Ca, participan en la generación de gradientes electroquímicos, imprescindibles en el mantenimiento del potencial de membrana y del potencial de acción y en la sinapsis neuronal.

  • Función tamponadora. Se lleva a cabo por los sistemas carbonato-bicarbonato, y también por el monofosfato-bifosfato.

GLÚCIDOS

Concepto de glúcidos

Monosacáridos

1.triosas

2.pentosas

3.hexosas

4.Ciclación de monosacáridos

Disacáridos

1.lactosa

2.maltosa

3.sacarosa

Polisacáridos

1.almidón

2.glucógeno

3.celulosa

CONCEPTO DE GLÚCIDOS

Los glúcidos son biomoléculas formadas básicamente por carbono (C),hidrógeno (H) y oxígeno (O).

Los átomos de carbono están unidos a grupos alcohólicos (-OH), llamados también radicales

hidroxilo y a radicales hidrógeno (-H).

En todos los glúcidos siempre hay un grupo carbonilo, es decir, un carbono unido a un oxígeno

mediante un doble enlace (C=O). El grupo carbonilo puede ser un grupo aldehído(-CHO), o un

grupo cetónico (-CO-). Así pues, los glúcidos pueden definirse como polihidroxialdehídos o

polihidroxicetonas.

El primer glúcido es el más pequeño que existe, tiene 3

átomos de carbono solamente, es además una aldosa porque

posee un

grupo aldehído (-CHO );

el segundo ejemplo correspondería a una cetosa, por tener un

grupo cetona (C=O )

Inicio de página

MONOSACÁRIDOS

Los monosacáridos son glúcidos sencillos, constituídos sólo por una cadena. Se nombran añadiendo

la terminación -osa al número de carbonos.

Por ejemplo, en el dibujo están representados una triosa, una tetrosa, una pentosa y una hexosa.

1.Las triosas , son abundantes en el interior de la célula, ya que son metabolitos intermediarios

de la degradación de la glucosa

2.Las pentosas, son glúcidos de 5 carbonos y entre ellos se encuentran: Ribosa y Desoxirribosa

, que forman parte de los ácidos nucléicos y la ribulosa que desempeña un importante papel

en la fotosíntesis, debido a que a ella se fija el CO2 atmosférico y de esta manera se

incorpora el carbono al ciclo de la materia viva.

3.Las hexosas , son glúcidos con 6 átomos de carbono. Entre ellas tienen interés en biología, la

glucosa y galactosa entre las aldohexosas y la fructosa entre las cetohexosas.

En disolución acuosa, los monosacáridos se cierran formando unos anillos de 5 ó 6 lados ,

furanos y piranos, respectivamente.

Aquí está representada la fórmula lineal y cíclica de la fructosa, formando un anillo de cinco lados que

corresponde al furano Al cerrarse la molécula el grupo -OH (marcado en rojo), puede ocupar dos posiciones,

respecto al grupo -CH2OH del C5. Son dos nuevos isómeros, denominados anómeros alfa (en posición trans)y

beta(en posición cis)

Estas fórmulas representan a la glucosa en su forma lineal y cíclica, en este caso el anillo formado tiene 6 lados

y corresponde al esqueleto pirano. Es el glúcido más abundante, llamado azúcar de uva; en la sangre se encuentra

en concentraciones de un gramo por litro Al polimerizarse da lugar a polisacáridos con función energética (almidón

y glucógeno) o con fución estructural, como la celulosa de las plantas.

Inicio de página

Ciclación de monosacáridos

En este esquema puede apreciarse como se cierra la molécula de un monosacárido, en este caso una hexosa. El grupo

carbonilo del C1 queda próximo al C5 y entre ellos reaccionan sus radicales en una reacción intramolecular entre un grupo

aldehido (el del C1) y un grupo alcohol (el del C5), formándose un hemiacetal.Ambos carbonos quedarán unidos mediante un

átomo de oxígeno. El C1 se denomina Carbono anomérico y posee un grupo -OH llamado hemiacetálico y según la posición

de este grupo, se originan dos anómeros (alfa y beta).

El estudio de la ciclación fue realizado por Haworth y se conoce con el nombre de proyección de Haworth

Inicio de página

DISACÁRIDOS

los disacáridos están formados por la unión de dos monosacáridos, que se realiza de dos formas:

1.Mediante enlace monocarbonílico, entre el C1 anomérico de un monosacárido y un C no

anomérico de otro monosacárido, como se ve en las fórmulas de la lactosa y maltosa. Estos

disacáridos conservan el carácter reductor .

LACTOSA

MALTOSA

2.Mediante enlace dicarbonílico, si se establece entre los dos carbonos anoméricos de los dos

monosacáridos, con lo que el disacárido pierde su poder reductor, por ejemplo como ocurre

en la sacarosa

SACAROSA

Inicio de página

POLISACÁRIDOS

Los polisacáridos están formados por la unión de muchos monosacáridos (puede variar entre 11 y

varios miles), mediante enlace O-glucosídico,similar al visto en disacáridos, con pérdida de una

molécula de agua por cada enlace. Tienen pesos moleculares muy elevados, no poseen poder

reductor y pueden desempeñar funciones de reserva energética o función estructural.Los

polisacáridos que tienen función de reserva energética presentan enlace a-glucosídico y son :

1.Almidón, que es el polisacárido de reserva propio de los vegetales, y está integrado por dos

tipos de polímeros:

la amilosa, formada por unidades de maltosa,unidas mediante enlaces a(1-4). Presenta

estructura helicoidal.

la amilopectina , formada también por unidades de maltosas unidas mediante enlaces

a(1-4), con ramificaciones en posición a(1-6).

POLÍMEROS QUE FORMAN EL ALMIDÓN

AMILOSA

AMILOPECTINA

2.Glucógeno es el polisacárido propio de los animales. Se encuentra abundantemente en el

hígado y en los músculos. Molécula muy similar a la amilopectina; pero con mayor abundancia

de ramificaciones.

Entre los polisacáridos estructurales, destaca la celulosa , que forma la pared celular de la célula

vegetal. Esta pared constituye un estuche en el que queda encerrada la célula, que persiste tras la

muerte de ésta.

La celulosa está constituída por unidades de b-glucosa, y la peculiaridad del enlace b(beta) hace a

la celulosa inatacable por las enzimas digestivas humanas, por ello, este polisacárido no tiene

interés alimentario para el hombre..

LÍPIDOS

Concepto de lípido

Clasificación de los lípidos

Los ácidos grasos

Características

Clasificación

Propiedades

Lípidos SAPONIFICABLES

1.Lípidos simples

Acilglicéridos

Ceras

2.Lípidos complejos

Fosfolípidos

Glucolípidos

Lípidos INSAPONIFICABLES

1.Terpenos

2.Esteroides

3.Prostaglandinas

Funciones de los lípidos

Libro de Biología

Concepto de Lípido

Los lípidos son biomoléculas orgánicas formadas básicamente por carbono e hidrógeno y

generalmente también oxígeno; pero en porcentajes mucho más bajos. Además pueden

contener también fósforo, nitrógeno y azufre .

Es un grupo de sustancias muy heterogéneas que sólo tienen en común estas dos

características:

1.Son insolubles en agua

2.Son solubles en disolventes orgánicos, como éter, cloroformo, benceno, etc.

Inicio de página

Clasificación de los lípidos

Los lípidos se clasifican en dos grupos, atendiendo a que posean en su

composición ácidos grasos (Lípidos saponificables) o no lo posean ( Lípidos

insaponificables ).

1.Lípidos saponificables

A.Simples

1.Acilglicéridos

2.Céridos

B.Complejos

1.Fosfolípidos

2.Glucolípidos

2.Lípidos insaponificables

A.Terpenos

B.Esteroides

C.Prostaglandinas

Principio de página

Ácidos grasos

Los ácidos grasos son moléculas formadas por una larga cadena

hidrocarbonada de tipo lineal, y con un número par de átomos de carbono.

Tienen en un extremo de la cadena un grupo carboxilo (-COOH).

Se conocen unos 70 ácidos grasos que se pueden clasificar en dos grupos :

Los ácidos grasos saturados sólo tienen enlaces simples entre los átomos

de carbono. Son ejemplos de este tipo de ácidos el mirístico (14C);el

palmítico (16C) y el esteárico (18C) .

Los ácidos grasos insaturados tienen uno o varios enlaces dobles en su

cadena y sus moléculas presentan codos, con cambios de dirección en los

lugares dónde aparece un doble enlace. Son ejemplos el oléico (18C, un

doble enlace) y el linoleíco (18C y dos dobles enlaces).

Propiedades de los ácidos grasos

Solubilidad. Los ácidos grasos poseen una zona hidrófila, el grupo

carboxilo (-COOH) y una zona lipófila, la cadena hidrocarbonada que

presenta grupos metileno (-CH2-) y grupos metilo (-CH3) terminales.

Esterificación. Un ácido graso se une a un alcohol mediante un enlace

covalente, formando un éster y liberándose una molécula de agua.

Saponificación.Es una reacción típica de los ácidos grasos, en la cual

reaccionan con álcalis y dan lugar a una sal de ácido graso, que se

denomina jabón.Las moléculas de jabón presentan simultáneamente una

zona lipófila o hifrófoba, que rehuye el contacto con el agua, y una zona

hidrófila o polar, que se orienta hacia ella, lo que se denomina

comportamiento anfipático.

Inicio de página

Lípidos simples

Son lípidos saponificables en cuya composición química sólo intervienen

carbono, hidrógeno y oxígeno.

Inicio de página

Acilglicéridos

Son lípidos simples formados por la esterificación de una,dos o tres moléculas

de ácidos grasos con una molécula de glicerina. También reciben el nombre de

glicéridos o grasas simples

Según el número de ácidos grasos, se distinguen tres tipos de estos lípidos:

los monoglicéridos, que contienen una molécula de ácido graso

los diglicéridos, con dos moléculas de ácidos grasos

los triglicéridos, con tres moléculas de ácidos grasos.

Los acilglicéridos frente a bases dan lugar a reacciones de saponificación en

la que se producen moléculas de jabón.

Inicio de página

Ceras

Ceras

Las ceras son ésteres de ácidos grasos de cadena larga, con alcoholes

también de cadena larga. En general son sólidas y totalmente insolubles en

agua. Todas las funciones que realizan están relacionadas con su

impermeabilidad al agua y con su consistencia firme. Así las plumas, el pelo ,

la piel,las hojas, frutos, están cubiertas de una capa cérea protectora.

Una de las ceras más conocidas es la que segregan las abejas para

confeccionar su panal. Inicio de página

Lípidos complejos

Son lípidos saponificables en cuya estructura molecular además de carbono,

hidrógeno y oxígeno, hay también nitrógeno,fósforo, azufre o un glúcido.

Son las principales moléculas constitutivas de la doble capa lipídica de la

membrana, por lo que también se llaman lípidos de membrana. Son tammbién

moléculas anfipáticas.

Inicio de página

Fosfolípidos

Se caracterizan pr presentar un ácido ortofosfórico en su zona polar. Son

las moléculas más abundantes de la membrana citoplasmática.

Algunos ejemplos de fosfolípidos

Inicio de página

Glucolípidos

Son lípidos complejos que se caracterizan por poseer un glúcido. Se

encuentran formando parte de las bicapas lipídicas de las membranas de

todas las células, especialmente de las neuronas. Se sitúan en la cara

externa de la membrana celular, en donde realizan una función de relación

celular, siendo receptores de moléculas externas que darán lugar a

respuestas celulares.

Inicio de página

Inicio de página

Terpenos

Son moléculas lineales o cíclicas que cumplen funciones muy variadas, entre los

que se pueden citar:

Esencias vegetales como el mentol, el geraniol, limoneno, alcanfor,

eucaliptol,vainillina.

Vitaminas, como la vit.A, vit. E, vit.K.

Pigmentos vegetales, como la carotina y la xantofila.

Inicio de página

Esteroides

Los esteroides son lípidos que derivan del esterano. Comprenden dos grandes

grupos de sustancias:

1.Esteroles: Como el colesterol y las vitaminas D.

2.Hormonas esteroideas: Como las hormonas suprarrenales y las hormonas

sexuales.

COLESTEROL

El colesterol forma parte estructural de las

membranas a las que confiere estabilidad. Es la

molécula base que sirve para la síntesis de casi

todos los esteroides

HORMONAS SEXUALES

Entre las hormonas sexuales se

encuentran la progesterona que

prepara los órganos sexuales

femeninos para la gestación y la

testosterona responsable de los

caracteres sexuales masculinos.

HORMONAS SUPRARRENALES

Entre las hormonas suprarrenales se encuentra la cortisona,

que actúa en el metabolismo de los glúcidos, regulando la

síntesis de glucógeno.

Inicio de página

Prostaglandinas

Las prostaglandinas son lípidos cuya molécula básica está constituída por 20

átomos de carbono que forman un anillo ciclopentano y dos cadenas alifáticas.

Las funciones son diversas. Entre ellas destaca la producción de sustancias

que regulan la coagulación de la sangre y cierre de las heridas; la aparición

de la fiebre como defensa de las infecciones; la reducción de la secreción de

jugos gástricos. Funcionan como hormonas locales.

Inicio de página

Funciones de los lípidos

Los lípidos desempeñan cuatro tipos de funciones:

1.Función de reserva. Son la principal reserva energética del

organismo.Un gramo de grasa produce 9'4 kilocalorías en las reacciones

metabólicas de oxidación, mientras que proteínas y glúcidos sólo

producen 4'1 kilocaloría/gr.

2.Función estructural. Forman las bicapas lipídicas de las membranas.

Recubren órganos y le dan consistencia, o protegen mecánicamente como

el tejido adiposo de piés y manos.

3.Función biocatalizadora. En este papel los lípidos favorecen o facilitan

las reacciones químicas que se producen en los seres vivos. Cumplen esta

función las vitaminas lipídicas, las hormonas esteroideas y las

prostaglandinas.

4.Función transportadora. El tranporte de lípidos desde el intestino hasta

su lugar de destino se raliza mediante su emulsión gracias a los ácidos

biliares y a los proteolípidos.

Inicio de página

Reacción de saponificación

Saponificación.Es una reacción típica de los ácidos grasos, en la cual

reaccionan con álcalis y dan lugar a una sal de ácido graso, que se denomina

jabón.Las moléculas de jabón presentan simultáneamente una zona lipófila o

hifrófoba, que rehuye el contacto con el agua, y una zona hidrófila o polar,

que se orienta hacia ella, lo que se denomina comportamiento anfipático.

Inicio de página

Reacción de esterificación

Esterificación. Un ácido graso se une a un alcohol mediante un enlace

covalente, formando un éster y liberándose una molécula de agua.

PROTEÍNAS

Concepto de proteína

Los aminoácidos

1.Clasificación y tipos

2.Comportamiento químico

El enlace peptídico

Estructura de las proteínas

1.E. Primaria

2.E. Secundaria

3.E. Terciaria

4.E. Cuaternaria

Propiedades de las proteínas

1.Especificidad

2.Desnaturalización

Clasificación de las proteínas

Funciones y ejemplos de proteínas

Indice de Biología

CONCEPTO DE PROTEÍNA

Las proteínas son biomóleculas formadas básicamente por carbono, hidrógeno,

oxígeno y nitrógeno. Pueden además contener azufre y en algunos tipos de

proteínas, fósforo, hierro, magnesio y cobre entre otros elementos.

Pueden considerarse polímeros de unas pequeñas moléculas que reciben el nombre

de aminoácidos y serían por tanto los monómeros unidad. Los aminoácidos están

unidos mediante enlaces peptídicos.

La unión de un bajo número de aminoácidos da lugar a un péptido; si el nº de aa. que

forma la molécula no es mayor de 10, se denomina oligopéptido, si es superior a 10

se llama polipéptido y si el nº es superior a 50 aa. se habla ya de proteína.

Inicio de proteínas

LOS AMINOÁCIDOS

Los aminoácidos se caracterizan por poseer un grupo carboxilo (-COOH) y un

grupo amino (-NH2).

Las otras dos valencias del carbono se saturan con un átomo de H y con un grupo

variable denominado radical R.

Según éste se distinguen 20 tipos de aminoácidos.

Inicio de proteínas

COMPORTAMIENTO QUÍMICO

En disolución acuosa, los aminoácidos muestran un comportamiento anfótero, es

decir pueden ionizarse, dependiendo del pH, como un ácido liberando protones y

quedando (-COO'), o como base , los grupos -NH2 captan protones, quedando como

(-NH3+ ), o pueden aparecer como ácido y base a la vez. En este caso los

aminoácidos se ionizan doblemente, apareciendo una forma dipolar iónica llamada

zwitterion

Inicio de proteínas

EL ENLACE PEPTÍDICO

Los péptidos están formados por la unión de aminoácidos mediante un enlace

peptídico. Es un enlace covalente que se establece entre el grupo carboxilo de un

aa. y el grupo amino del siguiente, dando lugar al desprendimiento de una molécula

de agua.

El enlace peptídico tiene un comportamiento similar al de un enlace doble, es decir,

presenta una cierta rigidez que inmoviliza en un plano los átomos que lo forman. Si

pinchas aquí podrás ver en animación la formación del enlace peptídico.

Inicio de proteínas

ESTRUCTURA DE LAS PROTEÍNAS

La organización de una proteína viene definida por cuatro niveles estructurales

denominados: estructura primaria, estructura secundaria, estructura terciaria y

estructura cuaternaria. Cada una de estas estructuras informa de la disposición de

la anterior en el espacio.

Inicio de proteínas

ESTRUCTURA PRIMARIA

La estructura primaria es la secuencia de aa. de la proteína. Nos indica qué aas.

componen la cadena polipeptídica y el orden en que dichos aas. se encuentran. La

función de una proteína depende de su secuencia y de la forma que ésta adopte.

Inicio de proteínas

ESTRUCTURA SECUNDARIA

La estructura secundaria es la disposición de la secuencia de aminoácidos en el

espacio.Los aas., a medida que van siendo enlazados durante la síntesis de proteínas

y gracias a la capacidad de giro de sus enlaces, adquieren una disposición espacial

estable, la estructura secundaria.

Existen dos tipos de estructura secundaria:

1.la a(alfa)-hélice

2.la conformación beta

Esta estructura se forma al enrollarse helicoidalmente sobre sí

misma la estructura primaria. Se debe a la formación de enlaces de

hidrógeno entre el -C=O de un aminoácido y el -NH- del cuarto

aminoácido que le sigue.

En esta disposición los aas. no forman una hélice sino una cadena en forma de

zigzag, denominada disposición en lámina plegada.

Presentan esta estructura secundaria la queratina de la seda o fibroína.

Inicio de proteínas

ESTRUCTURA TERCIARIA

La estructura terciaria informa sobre la disposición de la estructura secundaria de

un polipéptido al plegarse sobre sí misma originando una conformación globular.

En definitiva, es la estructura primaria la que determina cuál será la secundaria y

por tanto la terciaria..

Esta conformación globular facilita la solubilidad en agua y así realizar funciones

de transporte , enzimáticas , hormonales, etc.

Esta conformación globular se mantiene estable gracias a la existencia de enlaces

entre los radicales R de los aminoácidos. Aparecen varios tipos de enlaces:

1.el puente disulfuro entre los radicales de aminoácidos que tiene azufre.

2.los puentes de hidrógeno

3.los puentes eléctricos

4.las interacciones hifrófobas.

Inicio de proteínas

ESTRUCTURA CUATERNARIA

Esta estructura informa de la unión , mediante enlaces débiles ( no covalentes) de

varias cadenas polipeptídicas con estructura terciaria, para formar un complejo

proteico. Cada una de estas cadenas polipeptídicas recibe el nombre de protómero.

El número de protómeros varía desde dos como en la hexoquinasa, cuatro como en

la hemoglobina, o muchos como la cápsida del virus de la poliomielitis, que consta de

60 unidades proteícas.

Inicio de proteína

PROPIEDADES DE PROTEINAS

1.Especificidad.

La especificidad se refiere a su función; cada una lleva a cabo una

determinada función y lo realiza porque posee una determinada estructura

primaria y una conformación espacial propia; por lo que un cambio en la

estructura de la proteína puede significar una pérdida de la función.

Además, no todas las proteinas son iguales en todos los organismos, cada

individuo posee proteínas específicas suyas que se ponen de manifiesto en los

procesos de rechazo de órganos transplantados. La semejanza entre proteínas

son un grado de parentesco entre individuos, por lo que sirve para la

construcción de "árboles filogenéticos"

2.Desnaturalización.

Consiste en la pérdida de la estructura terciaria, por romperse los puentes

que forman dicha estructura. Todas las proteínas desnaturalizadas tienen la

misma conformación, muy abierta y con una interacción máxima con el

disolvente, por lo que una proteína soluble en agua cuando se desnaturaliza se

hace insoluble en agua y precipita.

La desnaturalización se puede producir por cambios de temperatura, (

huevo cocido o frito ), variaciones del pH. En algunos casos, si las condiciones

se restablecen, una proteína desnaturalizada puede volver a su anterior

plegamiento o conformación, proceso que se denomina renaturalización.

Principio de proteínas

CLASIFICACIÓN DE PROTEÍNAS

Se clasifican en :

1.HOLOPROTEÍNAS

Formadas solamente por aminoácidos

2.HETEROPROTEÍNAS

Formadas por una fracción proteínica y por un grupo no proteínico, que se

denomina "grupo prostético

HOLOPROTEÍNAS

Globulares

Prolaminas:Zeína (maíza),gliadina (trigo), hordeína (cebada)

Gluteninas:Glutenina (trigo), orizanina (arroz).

Albúminas:Seroalbúmina (sangre), ovoalbúmina (huevo), lactoalbúmina

(leche)

Hormonas: Insulina, hormona del crecimiento, prolactina, tirotropina

Enzimas: Hidrolasas, Oxidasas, Ligasas, Liasas, Transferasas...etc.

Fibrosas

Colágenos: en tejidos conjuntivos, cartilaginosos

Queratinas: En formaciones epidérmicas: pelos, uñas, plumas, cuernos.

Elastinas: En tendones y vasos sanguineos

Fibroínas: En hilos de seda, (arañas, insectos)

HETEROPROTEÍNAS

Glucoproteínas

Ribonucleasa

Mucoproteínas

Anticuerpos

Hormona luteinizante

Lipoproteínas

De alta, baja y muy baja densidad, que transportan lípidos en la sangre.

Nucleoproteínas

Nucleosomas de la cromatina

Ribosomas

Cromoproteínas

Hemoglobina, hemocianina, mioglobina, que transportan oxígeno

Citocromos, que transportan electrones

Principio de proteínas

FUNCIONES Y EJEMPLOS DE PROTEÍNAS

Estructural

Como las glucoproteínas que forman parte de las membranas.

Las histonas que forman parte de los cromosomas

El colágeno, del tejido conjuntivo fibroso.

La elastina, del tejido conjuntivo elástico.

La queratina de la epidermis.

Enzimatica

Son las más numerosas y especializadas. Actúan como biocatalizadores de las

reacciones químicas y puedes verlas y estudiarlas con detalle aquí.

Hormonal

Insulina y glucagón

Hormona del crecimiento

Calcitonina

Hormonas tropas

Defensiva

Inmunoglobulina

Trombina y fibrinógeno

Transporte

Hemoglobina

Hemocianina

Citocromos

Reserva

Ovoalbúmina, de la clara de huevo

Gliadina, del grano de trigo

Lactoalbúmina, de la leche

Principio de proteínas

ENZIMAS

Concepto de enzima

Concepto de catalizador

Características de la acción enzimática

1.Especificidad

de sustrato

de acción

2.Acción enzimática

3.Cofactor

4.Coenzima

5.Vitaminas

Efecto del pH y de la temperatura

Clasificación internacional de las enzimas

Indice de Biología

CONCEPTO DE ENZIMA

Los enzimas son catalizadores muy potentes y eficaces, químicamente son proteínas

Como catalizadores, los enzimas actúan en pequeña cantidad y se recuperan

indefinidamente.No llevan a cabo reacciones que sean energéticamente

desfavorables, no modifican el sentido de los equilibrios químicos, sino que aceleran

su consecución.

Principio de enzimas

CATALIZADOR

Un catalizador es una sustancia que acelera una reacción química, hasta hacerla

instantánea o casi instantánea. Un catalizador acelera la reacción al disminuir la

energía de activación.

En una transformación dada de "A" a "P" , "A" representa las moléculas reaccionantes, que constituyen el estado inicial.

"P" representa los productos o estado final. La reacción química de A a P es un proceso posible si la energía de P es menor

que la de A. Pero hay una barrera de energía que los separa; si no es por ella, A no existiría, puesto que no sería estable

y se habría transformado en P. Este escollo es una barrera energética, la energía de activación (Ea), que corresponde al

estado de transición.

Proteínas

CARACTERÍSTICAS DE LA ACCIÓN ENZIMÁTICA

La característica más sobresaliente de los enzimas es su elevada especificidad.

Esta es doble y explica que no se formen subproductos:

1.Especificidad de sustrato. El sustrato (S) es la molécula sobre la que el

enzima ejerce su acción catalítica.

2.Especificidad de acción. Cada reacción está catalizada por un enzima

específico.

La acción enzimática se caracteriza por la formación de un complejo que

representa el estado de transición.

E + S

ES

E + P

El sustrato se une al enzima a través de numerosas interacciones débiles como son:

puentes de hidrógeno, electrostáticas, hidrófobas, etc, en un lugar específico , el

centro activo. Este centro es una pequeña porción del enzima, constituído por una

serie de aminoácidos que interaccionan con el sustrato.

Algunas enzimas actúan con la ayuda de estructuras no proteícas. En función de

su naturaleza se denominan:

1.Cofactor. Cuando se trata de iones o moléculas inorgánicas.

2.Coenzima. Cuando es una molécula orgánica. Aquí se puede señalar, que

muchas vitaminas funcionan como coenzimas; y realmente las deficiencias

producidas por la falta de vitaminas responde más bien a que no se puede

sintetizar un determinado enzima en el que la vitamina es el coenzima.

Principio de enzimas

VITAMINAS

Algunas vitaminas son necesarias para la actuación de determinados enzimas, ya que funcionan

como coenzimas que intervienen en distintas rutas metabólicas y , por ello, una deficiencia en

una vitamina puede originar importantes defectos metabólicos, como puede verse en la tabla adjunta:

VITAMINAS

FUNCIONES

Enfermedades

carenciales

C (ácido ascórbico)

Coenzima de algunas peptidasas.

Interviene en la síntesis de colágeno

Escorbuto

B1 (tiamina)

Coenzima de las descarboxilasas y de las

enzima que transfieren grupos aldehidos

Beriberi

B2 (riboflavina)

Constituyente de los coenzimas FAD y

FMN

Dermatitis y lesiones en

las mucosas

B3 (ácido

pantoténico)

Constituyente de la CoA

Fatiga y trastornos del

sueño

B5 (niacina)

Constituyente de las coenzimas NAD y

NADP

Pelagra

B6 ( piridoxina)

Interviene en las reacciones de

transferencia de grupos aminos.

Depresión, anemia

B12 (cobalamina)

Coenzima en la transferencia de grupos

metilo.

Anemia perniciosa

Biotina

Coenzima de las enzimas que transfieren

grupos carboxilo, en metabolismo de

aminoácidos.

Fatiga, dermatitis...

EFECTO DEL pH Y TEMPERATURA

1.Efecto del pH. Al comprobar experimentalmente la influencia del pH en la velocidad de las

reacciones enzimáticas se obtienen curvas que indican que los enzimas presentan un pH

óptimo de actividad. El pH puede afectar de varias maneras:

El centro activo puede contener aminoácidos con grupos ionizados que pueden variar

con el pH.

La ionización de aminoácidos que no están en el centro activo puede provocar

modiicaciones en la conformación de la enzima.

El sustrato puede verse afectado por las variaciones del pH.

Algunos enzimas presentan variaciones peculiares. La pepsina del estómago, presenta un

óptimo a pH=2, y la fosfatasa alcalina del intestino un pH= 12

2.La temperatura. Influye en la actividad. El punto óptimo representa el máximo de actividad.

A temperaturas bajas, los enzimas se hallan "muy rígidos" y cuando se supera un valor

considerable (mayor de 50º) la actividad cae bruscamente porque, como proteína, el enzima

se desnaturaliza.

Principio de enzimas

CLASIFICACIÓN DE ENZIMAS

1. Óxido-reductasas

( Reacciones de oxido-reducción).

Si una molécula se reduce, tiene que haber otra que se

oxide

2. Transferasas

(Transferencia de grupos funcionales)

grupos aldehidos

gupos acilos

grupos glucosilos

grupos fosfatos (kinasas)

3. Hidrolasas

(Reacciones de hidrólisis)

Transforman polímeros en monómeros.

Actuan sobre:

enlace éster

enlace glucosídico

enlace peptídico

enlace C-N

4. Liasas

(Adición a los dobles enlaces)

Entre C y C

Entre C y O

Entre C y N

5. Isomerasas

(Reacciones de isomerización)

6. Ligasas

(Formación de enlaces, con aporte de

ATP)

Entre C y O

Entre C y S

Entre C y N

Entre C y C

ÁCIDOS NUCLEICOS

Los ácidos nucléicos son grandes moléculas formadas por la repetición de una molécula unidad que es el nucleótido.Pero a su vez, el nucleótido es una molécula compuesta por tres:

1.Una pentosa

ribosa

desoxirribosa

2.Ácido fosfórico

3.Una base nitrogenada,que puede ser una de estas cinco

adenina

guanina

citosina

timina

uracilo

Los ácidos nucléicos están formados por largas cadenas de nucleótidos, enlazados entre sí por el grupo fosfato. Pueden alcanzar tamaños gigantes, siendo las moléculas más grandes que se conocen, constituídas por millones de nucleótidos. Son las moléculas que tienen la información genética de los organismos y son las responsables de su transmisión hereditaria. Existen dos tipos de ácidos nucléicos, ADN y ARN, que se diferencian por el azúcar (pentosa) que llevan: desoxirribosa y ribosa, respectivamente. Además se diferencian por las bases nitrogenadas que contienen, adenina , guanina, citosina y timina, en el ADN; y adenina, guanina, citosina y uracilo en el ARN. Una última diferencia está en la estructura de las cadenas, en el ADN será una cadena doble y en el ARN es una cadena sencilla.

ADN

La molécula de ADN está constituída por dos largas cadenas de nucleótidos unidas entre sí formando una doble hélice. Las dos cadenas de nucleótidos que constituyen una molécula de ADN, se mantienen unidas entre sí porque se forman enlaces entre las bases nitrogenadas de ambas cadenas que quedan enfrentadas. La unión de las bases se realiza mediante puentes de hidrógeno, y este apareamiento está condicionado químicamente de forma que la adenina (A) sólo se puede unir con la Timina (T) y la Guanina (G) con la Citosina (C). La estructura de un determinado ADN está definida por la "secuencia" de las bases nitrogenadas en la cadena de nucleótidos, residiendo precisamente en esta secuencia de bases la información genética del ADN. El orden en el que aparecen las cuatro bases a lo largo de una cadena en el ADN es, por tanto, crítico para la célula, ya que este orden es el que constituye las instrucciones del programa genético de los organismos. Conocer esta secuencia de bases, es decir, secuenciar un ADN equivale a descifrar su mensaje genético. La estructura en doble hélice del ADN, con el apareamiento de bases limitado (A-T; G-C ), implica que el orden o secuencia de bases de una de las cadenas delimita automaticamente el orden de la otra, por eso se dice que las cadenas son complementarias. Una vez conocida la secuencia de las bases de una cadena ,se deduce inmediatamente la secuencia de bases de la complementaria. El modelo de la doble hélicede Watson y Crick ha supuesto un hito en la historia de la Biología.

REPLICACIÓN DEL ADN

Es la capacidad que tiene el ADN de hacer copias o réplicas de su molécula. Este proceso es fundamental para la transferencia de la información genética de generación en generación. Las moléculas se replican de un modo semiconservativo. La doble hélice se separa y cada una de las cadenas sirve de molde para la síntesis de una nueva cadena complementaria. El resultado final son dos moléculas idénticas a la original.

TRANSFERENCIA DE LA INFORMACIÓN

El ADN tiene la información para hacer las proteínas de la célula. Ya que muchas de estas proteínas funcionan como enzimas en las reacciones químicas que tienen lugar en la célula,todos los procesos celulares dependen, en última instancia, de la información codificada en el ADN. En el proceso de síntesis de proteínas, existe una molécula, el ARN, que actúa de intermediaria. Por lo tanto, en el proceso de expresión de la información contenida en los genes hay dos etapas:

La primera se denomina TRANSCRIPCIÓN y la segunda TRADUCCIÓN. Esto se ha dado en llamar el "dogma central de la Biología Molecular". El "dogma central" admite excepciones. Temin descubrió una enzima, la transcriptasa inversa que es capaz de sintetizar ADN copiando la información contenida en un ARN. El papel biológico de esta enzima es fundamental en los retrovirus , cuyo material genético es ARN en vez de ADN. El virus del S.I.D.A. es un retrovirus.

SÍNTESI DE ARN

El proceso de síntesis de ARN o TRANSCRIPCIÓN, consiste en hacer una copia complementaria de un trozo de ADN. El ARN se diferencia estructuralmente del ADN en el azúcar, que es la ribosa y en una base, el uracilo, que reemplaza a la timina. Además el ARN es una cadena sencilla.

En una primera etapa, una enzima, la ARN-polimerasa se asocia a una región del ADN,denominada promotor, la enzima pasa de una configuración cerrada a abierta, y desenrolla una vuelta de hélice, permitiendo la polimerización del ARN a partir de una de las hebras de ADN que se utiliza como patrón.

La ARN-polimerasa, se desplaza por la hebra patrón, insertando nucleótidos de ARN, siguiendo la complementariedad de bases, así p.e.

Secuencia de ADN:

3'... TACGCT...5'

Secuencia de ARNm:

5'...UAGCGA...3'

Cuando se ha copiado toda la hebra, al final del proceso , la cadena de ARN queda libre y el ADN se cierra de nuevo, por apareamiento de sus cadenas complementarias. De esta forma, las instrucciones genéticas copiadas o transcritas al ARN están listas para salir al citoplasma. El ADN, por tanto, es la "copia maestra" de la información genética, que permanece en "reserva" dentro del núcleo. El ARN, en cambio, es la "copia de trabajo" de la información genética. Este ARN que lleva las instrucciones para la síntesis de proteínas se denomina ARN mensajero.

SÍNTESIS DE PROTEÍNAS

El ARN mensajero es el que lleva la información para la síntesis de proteínas, es decir, determina el orden en que se unirán los aminoácidos. Esta información está codificada en forma de tripletes, cada tres bases constituyen un codón que determina un aminoácido. Las reglas de correspondencia entre codones y aminoácidos constituyen el código genético. La síntesis de proteínas o traducción tiene lugar en los ribosomas del citoplasma. Los aminoácidos son transportados por el ARN de transferencia, específico para cada uno de ellos, y son llevados hasta el ARN mensajero, dónde se aparean el codón de éste y el anticodón del ARN de transferencia, por complementariedad de bases, y de ésta forma se sitúan en la posición que les corresponde. Una vez finalizada la síntesis de una proteína, el ARN mensajero queda libre y puede ser leído de nuevo. De hecho, es muy frecuente que antes de que finalice una proteína ya está comenzando otra, con lo cual, una misma molécula de ARN mensajero, está siendo utilizada por varios ribosomas simultanéamente.

CÓDIGO GENÉTICO

El código genético viene a ser un diccionario molecular. Constituye las reglas de correspondencia entre los codones (grupo de tres nucleótidos) y los aminoácidos El codón, constituye una palabra en el lenguaje de los ácidos nucléicos, y esta palabra es traducida por un aminoácido. Este código es universal, desde las bacterias hasta el hombre. Es decir, la interpretación de los codones por aminoácidos es igual en todas las células, todas "leen" de la misma manera los genes.

REGULACIÓN DE LA EXPRESIÓN GENETICA

Todas las células presentan mecanismos para regular la expresión de los genes. De esta manera, las células procariotas y eucariotas, sintetizan en cada momento solamente aquellos elementos que necesitan.

A principios de los años sesenta, Jacob y Monod, del Instituto Pasteur de París, propusieron un modelo denominado operón para la regulación de la expresión génica en las bacterias.

En cada operón se diferencian dos clases de genes:

Los genes estructurales ( E1, E2, E3...), que codifican proteínas, participantes en un determinado proceso bioquímico. Un gen regulador (R), que codifica a una proteína represora (PR) que puede encontrarse en la forma activa o inactiva y es el agente que controla materialmente la expresión.

Existen además dos regiones que intervienen en la regulación:

El promotor (P),es una zona donde se une la ARN-polimerasa y decide el inicio de la transcripción. El operador (O), que posee una secuencia reconocida por la proteina represora activa: cuando se bloquea el operador con la proteína represora, impide el avance de la ARN-polimerasa y la transcripción se interrumpe, con lo que se origina el proceso conocido como represión génica. Cuando la bacteria necesita sintetizar proteínas debe separar el operador del represor y utiliza para ello dos tácticas:

1.La inducción enzimática.Como en el caso del operón lactosa, que regula la síntesis de las enzimas encargadas de metabolizar la lactosa.

2.La represión enzimática. El ejemplo es el operón histidina, que regula la síntesis de las enzimas que intervienen en la síntesis de la histidina.

ACTIVIDADES DE ÁCIDOS NUCLEICOS

  • ¿Qué molécula resulta más estable químicamente, la de ADN o la de ARN?. ¿A qué se debe esta estabilidad?.

  • Define qué es un nucleótido, escribiendo la fórmula de uno cualquiera que justifique tal definición.

  • ¿Qué nucleótidos forman el ADN y cuáles el ARN ?.

  • ¿Qué quiere decir que las dos cadenas que forman el ADN son complementarias?.

  • ¿Qué relación hay entre este hecho y las llamadas reglas de Chargaff?

  • Indica las diferencias de función y localización que encuentras entre los tipos más importantes de ARN?.

  • Enumera las diferencias que existen entre el ADN y el ARN , en cuanto a composición química, estructura molecular, tamaño y localización en una célula eucariótica.

  • ACTIVIDADES DE BIOQUÍMICA

    1. Haz una clasificación cuantitativa de los bioelementos.

    2. Cita dos características que hagan del carbono un elemento idóneo para

    formar parte de las moléculas de los seres vivos.

    3. Haz un esquema de la molécula de H2O . ¿ Por qué se dice que en teoría

    el agua es una molécula neutra y en la práctica no ?.

    4. Explica por qué la molécula de agua se considera un dipolo.

    5. Haz un esquema que indique como se disocia la molécula de H2O.

    6. Comenta tres reacciones biológicas en las que el agua actue como

    reactivo.l

    7. Haz una relación de las propiedades de la molécula de agua.

    8. Haz un esquema en el que se vea como la molécula de agua disocia a una

    sal.

    9. Explica y pon las reacciones necesarias para ver como se solucionaría un

    aumento en la alcalinidad de nuestro medio interno.

    10. Explica qué ocurriría si a una persona se le inyectara en vena una

    solución salina hipotónica con el plasma sanguineo.

    11. Define los siguientes términos: oligoelemento, biomolécula, plasmolisis y

    turgencia.

    12. Observa la siguiente tabla de contenido en agua en diferentes órganos

    del ser humano, y trata de razonar el sentido biológico de dicha distribución:

    cerebro

    sangre

    músculos

    hígado

    cartílagos

    huesos

    dientes

    86%

    79%

    75%

    70%

    55%

    22%

    10%

    13. Relaciona mediante flechas los siguientes elementos minerales con el

    papel que realizan:

    Hierro

    Flúor

    Fósforo

    Calcio

    Yodo

    Se deposita en los huesos

    Componente de la molécula de hemoglobina

    Se localiza en dientes y huesos

    Necesario para el tiroides

    Componente del ADN

    14. ¿Por qué el agua es un dipolo?. Señala una de sus propiedades

    físico-químicas e indica las funciones biológicas que le permite realizar.

    15.

    1.¿Qué ocurriría si se colocaran en agua marina glóbulos rojos de la

    sangre?

    2.¿ Y si se colocaran células vegetales?

    16. Indica las semejanzas y diferencias entre difusión, diálisis y ósmosis.

    17. Señala alguna función específica de los cationes de Na+ y K+.

    18. Si tenemos una disolución de sulfato de cobre al 10%,(disolución A)

    separada por una membrana semipermeable , de otra disolución de sulfato de

    cobre al 5%(disolución B).¿El agua se difundirá desde la solución A hasta la

    B, o desde la B hasta la A?. Razónalo.

    19. El siguiente cuadro indica el pH de las disoluciones.

    Bioelementos

    ¿Qué disoluciones son ácidas?. Indícalas de mayor a menor grado de

    acidez.

    ¿Existen algunas disoluciones neutras?, ¿y básicas?. Si es asi, ¿cuáles?:

    20. Señala de forma razonada si son verdaderas o falsas las siguientes

    expresiones:

    El fósforo es imprescindible para la vida animal y vegetal

    Cuanto más activo es un órgano más hidratado está y viceversa

    El agua alcanza su máxima densidad al convertirse en hielo

    Los iones minerales ayudan a mantener el pH de los líquidos biológicos.

    21. Siendo el SILICIO unas 146 veces más abundante en la corteza

    terrestre que el CARBONO, y siendo su posición contigua en el sistema

    periódico, ¿qué propiedades del carbono han hecho que se seleccione en el

    proceso de evolución frente al silicio?.

    22. ¿Quienes influyen más en la plasmolisis de una célula vegetal, los

    glúcidos y los cationes disueltos en el medio externo?. ¿Y en la turgescencia?.

    Razónalo.

    23. ¿Qué ocurriría si se inyectase a una persona agua destilada?.¿Por qué ?:

    24. Si se elimina la pared celular de un tejido vegetal por procesos

    enzimáticos, las células quedarán con la membrana plasmática únicamente. ¿Se

    darán fenómenos de turgescencia?. ¿Qué ocurrirá con las células en un tejido

    vegetal así tratado?.

    25. ¿Por qué a un filete, y en general a toda la carne, no conviene salarla

    hasta qué esté dorada?.

    26. Define los siguientes conceptos: enlace O-glucosídico, carbono

    anomérico.

    27. ¿A qué tipo de molécula corresponde la sacarosa?. ¿Tomas

    habitualmente en estado puro este disacárido?. ¿Cuándo?.

    28. Indica las semejanzas y diferencias entre:

    la celulosa y el almidón

    la celulosa y la quitina

    el almidón y el glucógeno.

    29. A la vista de las fórmulas estructurales de los monosacáridos, escribe la

    estructura de dos disacáridos cualesquiera con poder reductor y de dos

    disacáridos sin poder reductor.

    30. Pon las fórmulas lineales y cíclicas de la glucosa. Indica en cada una de

    ellas el nº de isómeros que tienen y como se llaman.

    31. Construye un disacárido, di el enlace que se forma y su posible

    comportamiento, si se le tratara con el Reactivo de Fheling.

    32.

    ¿Cuáles son los glúcidos de almacenamiento en los vegetales?. Escribe la

    estructura molecular de los mismos

    Describe qué experiencia llevarías a cabo para averiguar si un

    determinado tallo convierte glucosa en polisacárido.

    La gráfica muestra las cantidades relativas de glúcidos en hojas y

    tubérculos de una planta de patata.

    Bioelementos

    Interprétala indicando los cambios bioquímicos que se producen

    esquematiza las correspondientes reacciones.

    33. Define los siguientes conceptos: lipófobo, anfipático, esterificación,

    hidrófobo.

    34. Relaciona mediante flechas los siguientes lípidos con el grupo al que

    pertenecen:

    fosfoglicérido

    terpeno

    esteroide

    esfingolípido

    triglicérido

    ácido graso

    colesterol

    ácido oléico

    cerebrósido

    tripalmitina

    lecitina

    vitamina A

    35. ¿Qué es un jabón?. Explica cómo se forma.

    36.colesterol y la vitamina D?

    37. Si te dan la fórmula estructural de un ácido graso, ¿en qué te basarías para conjeturar

    que se trata de una sustancia sólida o líquida a temperatura ambiente?.

    38. Ahora recordamos el cuento de Blancanieves...La bruja le regaló una bonita manzana

    roja que antes había frotado para sacarle un brillo espectacular.

    ¿Qué tipo de lípido tienen en su piel la manzana y otros frutos?

    ¿Qué función tienen?

    39. En el tubo digestivo, las enzimas proteolíticas van transformando progresivamente las

    proteinas en péptidos y éstos en aminoácidos, ¿ Qué tipo de enlaces e interacciones han de

    romper para conseguir estas transformaciones?.

    40. Indica si son verdaderas o falsas las siguientes afirmaciones. Razona las respuestas.

    La estructura secundaria de las proteínas puede ser globular o fibrosa.

    En la desnaturalización de las proteínas se rompen los enlaces peptídicos.

    41. La tabla siguiente muestra el espectro de actividad de una enzima frente a la

    Bioelementos
    temperatura:

    Haz la gráfica y comenta la relación entre temperatura y actividad enzimática

    42. Basándote en la función que realizan las siguientes proteínas, o en la localización de las

    mismas en los distintos tejidos o materiales, ¿podrías indicar si son globulares o fibrosas?

    Elastina (tejido conjuntivo)

    Lactasa (enzima)

    Fibroína ( seda)

    Hemoglobina (transporte de oxígeno)

    Queratina (uñas)

    43. Define los siguientes conceptos: metabolito, energía de activación, reacción

    exoergónica, apoenzima, sustrato, producto.

    44. Indica qué clases de reacciones catalizan las siguientes enzimas:

    piruvato-quinasa

    fosfoglucomutasa

    ADN-polimerasa

    succinato-deshidrogenasa

    45. En la figura siguiente se representa la relación entre el pH y la actividad catalítica de tres

    Bioelementos
    enzimas, la pepsina (P), la tripsina (T) y la fosfatasa alcalina (F).

    Indica los valores de pH para los cuales dos enzimas tienen la misma velocidad de

    reacción.

    Determina el intervalo del pH para el cual tiene actividad catalítica las tres enzimas,

    pero con velocidades de reacción distintas.

    Para valores máximos de acidez , ¿cuál es la enzima con mayor actividad catalítica?

    ¿Qué valores y qué unidades se emplean para representar la velocidad de reacción?.

    Si el pH de la sangre es 7'3 , razona qué enzimas podrían presentar actividad catalítica

    en el plasma sanguíneo.

    46. ¿Qué molécula resulta más estable químicamente, la de ADN o la de ARN?. ¿A qué se

    debe esta estabilidad?.

    47. Define qué es un nucleótido, escribiendo la fórmula de uno cualquiera que justifique tal

    definición

    48. ¿Qué nucleótidos forman el ADN y cuáles el ARN ?.

    49.< ¿Qué quiere decir que las dos cadenas que forman el ADN son complementarias?.

    ¿Qué relación hay entre este hecho y las llamadas reglas de Chargaff?

    50. Indica las diferencias de función y localización que encuentras entre los tipos más

    importantes de ARN?.

    51. Enumera las diferencias que existen entre el ADN y el ARN , en cuanto a composición

    química, estructura molecular, tamaño y localización en una célula eucariótica.

    ACTIVIDADES DE GENÉTICA

    1. ¿Cuál es el concepto actual de gen?.

    2. ¿Qué función realizan en general las ADN polimerasas y las ARN

    polimerasas?

    3. ¿Qué se entiende por "dogma central de la Biología Molecular"?

    4. ¿Qué significa qué el código genético es altamente específico y al mismo

    tiempo degenerado?. ¿Puede ésto ofrecer alguna ventaja?.

    5. Señala los aspectos diferentes que encuentras entre replicación y

    transcripción.¿ Qué tienen en común?

    6. ¿Qué es una mutación génica?. Discute brevemente las posibilidades de

    que se hereden tales mutaciones en un ser unicelular o en uno pluricelular.

    Cita algunos ejemplos de mutaciones génicas.

    7. ¿Qué se entiende por ingeniería genética?. ¿Conoces algunas de sus

    aplicaciones actuales?:

    8. Observa los siguientes esquemas, relativos al funcionamiento de los

    ácidos nucléicos, e indica cuáles son verdaderos y cuáles son falsos:

    Bioelementos

    9. Se realiza el análisis químico de un ácido nucléico y nos va suministrando

    progresivamente la información. Se escribe a continuación , por orden

    cronológico, la información que nos suministran. Conjetura después de cada

    etapa el tipo de ácido nucléico que se está analizando, y justifica tu

    respuesta:

    Contiene un hidrato de carbono que es la ribosa

    Contiene un 13% de uracilo, un 25% de adenina, un 28% de guanina y un

    34% de citosina.

    Su peso molecular es de 200.000

    10. ¿Qué quiere decir que en la replicación del ADN una cadena se copia de

    forma continua y la otra lo hace de forma discontinua y desfasada?.

    11. Cita algún mecanismo de reparación del ADN en el que intervenga una

    ADN polimerasa.

    12. En la purificación de un fragmento de ADN se ha perdido una porción de

    una de las dos hebras, quedando la secuencia de bases nitrogenadas como se

    indica a continuación. Reconstruye la porción que falta y explica en qué te

    basas para reconstruirla.

    ATTACC.................

    TAATGGGCCGAATTCGGCTAAGCT

    13. Si el ácido nucléico que se estuviera purificando fuera ARN , ¿podrías

    reconstruir una porción perdida con la misma facilidad que lo has hecho en la

    cuestión anterior?. ¿Qué datos necesitarías para intentar dicha

    reconstrucción?:

    14. En la purificación de unas moléculas de ARNt se obtiene un fragmento

    cuya secuencia de bases nitrogenadas es la siguiente:

    AUACGGCUAUCAGA

    UAUGCCGAUAGUCU

    ¿Puede encontrarse en ese fragmento la secuencia del anticodón?. Razona tu

    respuesta.

    15. Define brevemente los siguientes conceptos:

    nucleótido

    polinucleótido

    cromatina

    brazo aceptor del ARNt

    desnaturalización del ADN

    anticodón

    16. La siguiente secuencia de bases corresponde a un fragmento de una

    hebra de ADN:

    T A C C A A C G G C A T

    Escribe el ARNm resultante de su transcripción.

    ¿ A cuántos codones del ARNm da lugar este fragmento?. Por tanto,

    ¿cuántos aminoácidos codifica?. ¿Qué aminoácidos son éstos?.

    ¿Qué codones deben aparecer al principio y al final de este fragmento

    de ADN?. Escríbelos.

    ¿Qué otras moléculas son necesarias para la síntesis de este

    tetrapéptido?.

    17. Imagina que deseas obtener el siguiente tripéptido: HIS- PHE- LYS

    ¿Puedes fabricar el fragmento de ADN necesario para esta síntesis?

    ¿Qué posible secuencia de bases utilizarías?

    No olvides que el tripéptido tiene un principio y un final. Nombra

    cuantas moléculas más tendrían que intervenir, y no dejes de indicar el

    número de cada una de ellas.

    18. Consultando la tabla de la clave genética, señala el polipéptido que

    saldría de este trozo de ADN:

    T A C G C T G C G A T A A A C A T T G C T C G A G A T

    19. ¿Qué quiere decir crecimiento 53. ?

    20. ¿Cómo definirías el concepto de mutación?.

    21. Dibuja la estructura funcionante del operón lac.

    22. Función de los ribosomas en la síntesis de proteínas.

    23. Explicar el siguiente esquema:

    Bioelementos

    ¿Es correcto este esquema?. Razona la respuesta.

    24. Teniendo en cuenta la tabla del código genético, establece todos los

    pasos que conducirán a la síntesis del péptido:

    leucina-alanina-prolina-serina-arginina-arginina-valina

    indicando:

    Una secuencia entre todas las posibles, del ADN bicatenario

    correspondiente, teniendo en cuenta que el codón de iniciación es el

    AUG en el ARNm.

    La secuencia de codones del ARNm.

    El número de ARNt que intervendrán en el proceso y sus anticodones

    específicos.

    25. La secuencia de bases de una de las hebras de un fragmento de ADN es:

    3' A A T C C G C G C T A T T A T C G T 5'

    Representar:

    La cadena complementaria

    Replicar el fragmento formado siendo el punto de iniciación el extremo izquierdo.

    Señalar la dirección de síntesis en ambas hebras, así como el modo de síntesis (continua o discontinua).

    Explicar por qué la síntesis resulta:

    semiconservativa

    bidireccional

    discontinua