Ingeniería Genética

Genética. ADN (Ácido Desoxirribonucleico). Genes. Proteínas. Biotecnología. Descubrimientos genéticos

  • Enviado por: Wilmer
  • Idioma: castellano
  • País: Venezuela Venezuela
  • 85 páginas
publicidad

Introducción

Todo organismo, aún el más simple, contiene una enorme cantidad de información. Esta información se encuentra almacenada en una macromolécula que se halla en todas las células: el ADN. Este ADN está dividido en gran cantidad de sub-unidades (la cantidad varía de acuerdo con la especie) llamadas genes. Cada gen contiene la información necesaria para que la célula sintetice una proteína. Así, el genoma (y por consecuencia el proteoma), va a ser la responsable de las características del individuo. Los genes controlan todos los aspectos de la vida de cada organismo, incluyendo metabolismo, forma, desarrollo y reproducción. Por ejemplo, la síntesis una proteína X hará que en el individuo se manifieste el rasgo "pelo oscuro", mientras que la proteína Y determinará el rasgo "pelo claro".

Vemos entonces que la carga genética de un determinado organismo no puede ser idéntica a la de otro, aunque se trate de la misma especie. Sin embargo, debe ser en rasgos generales similar para que la reproducción se pueda concretar. Y es que una de las propiedades más importantes del ADN, y gracias a la cual fue posible la evolución, es la de dividirse y fusionarse con el ADN de otro individuo de la misma especie para lograr descendencia diversificada.

Otra particularidad de esta molécula es su universalidad. No importa cuán diferente sean dos especies: el ADN que contengan será de la misma naturaleza: ácido nucleico. Siguiendo este razonamiento, y teniendo en cuenta el concepto de gen, surgen algunas incógnitas: ¿Son compatibles las cargas genéticas de especies distintas? ¿Puede el gen de una especie funcionar y manifestarse en otra completamente distinta? ¿Se puede aislar y manipular el ADN?

La respuesta a todas estas preguntas se resume en dos palabras: Ingeniería Genética.

La ingeniería genética es una aplicación de la biotecnología que involucra la manipulación de ADN y el traslado de genes entre especies para incentivar la manifestación de rasgos genéticos deseados (OTA 1992). Aunque hay muchas aplicaciones de la ingeniería genética en la agricultura, el enfoque actual de la biotecnología esta en el desarrollo de cultivos tolerantes a herbicidas, así como en cultivos resistentes a plagas y enfermedades. También se esta trabajando con ganado vacuno para incrementar la producción de leche o carne.

Siempre que los productos de la biotecnología sigan estrechamente el paradigma de los plaguicidas, los productos modificados genéticamente reforzaran el espiral de los plaguicidas en los agroecosistemas, legitimando así las preocupaciones que tantos científicos han expresado con respecto a los posibles riesgos medioambientales de organismos genéticamente modificados.

Los impactos potenciales de la biotecnología se evalúan aquí dentro del contexto de metas agroecológicas que apuntan hacia una actividad agropecuaria socialmente más justa, económicamente viable y ecológicamente apropiada (Altleri 1996).

La mayoría de las innovaciones en biotecnología están orientadas por la búsqueda de ganancias en lugar de la búsqueda de una respuesta a las necesidades humanas, por consiguiente el énfasis de la industria de la ingeniería genética realmente no es resolver los problemas agropecuarios, sino el incremento de la rentabilidad. Esta aseveración es apoyada por el hecho que por lo menos 27 corporaciones han comenzado investigaciones sobre plantas tolerantes a los herbicidas, incluyendo a las ocho más grandes compañías de plaguicidas del mundo, Bayer, Ciba-Geigy, ICI, Rhone-Poulenc, Dow/Elanco, Monsanto, Hoescht y Dupont, y virtualmente todas las compañías de semillas, muchas de las cuales han sido adquiridas por compañías químicas (Gresshoft 1996).

El ABC de la Biotecnología

Capturando el gen.

1. Todo ser viviente esta conformado de células.

2. Las plantas mayores y animales tienen núcleo dentro de sus células; los organismos menores, como las bacterias, no lo tienen.

3. Cada célula contiene la información genética para todo el organismo.

4. Toda vez que una célula se divide, crea una nueva copia de su información genética.

"La herencia de los caracteres"


1. Cada célula de una planta tiene cromosomas apareados, dentro de su núcleo.

2. La información de todos los caracteres de una planta esta contenida en sus cromosomas.

3. Durante la fertilización, cada parental contribuye con un set (conjunto) de cromosomas.

4. Cada célula tiene el set completo de la información genética de la planta: "su genoma".

"Los genes"

1. La información genética en los cromosomas consiste en cadenas extremadamente largas de ADN.

2. Los genes son segmentos discretos de ADN, codificando para información especifica.

3. La expresión de un gen es controlada por secciones vecinas del ADN.

4. En las células de cada tejido (raíz, hoja, semillas), solo ciertos genes "están prendidos", o sea que su función se expresa.

"El ADN"

1. El ADN existe como doble cadena helicoidal.

2. El ADN esta "escrito" con solo cuatro bases.

3. Cada base siempre se complementa con su contraparte, en la otra cadena.

A: Adenina
T: Timina
G: Guanina
C: Citosina

4. Cuando el ADN se copia, cada cadena es el molde para la creación de su cadena complementaria.

"La Proteína"

1. Hay 20 diferentes aminoácidos que conforman la mayoría de las proteínas.

2. Las proteínas son cadenas de cientos de aminoácidos unidos por péptidos, en diferentes secuencias.

3. Las proteínas se organizan en complejas formas tridimensionales, que determinan sus propiedades y funciones.


4. Diferentes proteínas tienen diversas funciones: enzimas, elementos estructurales, toxinas, almacenaje...

El ADN sirve como molde para la síntesis del ARN


1. Una de las bases del ARN es diferente.

A (ADN) se complementa con U (ARN)
T (ADN) se complementa con A (ARN)
G (ADN) se complementa con C (ARN)
C (ADN) se complementa con G (ARN)


2. Una secuencia del ADN, llamada promotor, le ordena a la célula comenzar a construir ARN mensajero, a partir del gen que le sigue.


3.
Luego, cabeza y cola, se agregan al ARNm antes de dejar el núcleo.

4. El ARNm terminado puede ahora servir de molde para la correspondiente proteína.

El Código genético:

Traducción de ARN en proteína

1. Cada tres bases en el ARN, forman un codón correspondiente a ciertos aminoácidos.


2. La mayoría de los aminoácidos pueden ser codificados por mas de un codón.

Aac.

Codones

Cisteina
Prolina
Histidina

UGU,UGC
CCU,CCC,CCA,CCG
CAU,CAC

Stop= UAA, UAG, UGA


3. También hay codones, que ordenan a la maquinaria de la célula, detener la síntesis de la cadena proteica.

4. Todo este proceso es llevado a cabo por estructuras complejas, llamados ribosomas, junto con enzimas y moléculas especiales de ARN.

Construcción de una Proteína:

Traducción del ARNm

1. Los ribosomas se mueven a lo largo del ARNm y van adosando los aminoácidos correspondientes a cada codón.

2. Los aminoácidos se unen entre si por ligaduras de péptidos.

3. La cadena proteica toma una forma tridimensional, basada en la secuencia particular de aminoácidos.

4. Esta forma particular, es la que le confiere propiedades y funciones únicas.

Resumen:

Pasos desde ADN a Proteína

  • Un gen es parte del ADN, en un cromosoma.

  • 2. El código genético es "transcripto" en el ARN mensajero.

  • 3. El ARNm forma una cabeza y una cola para dejar el núcleo..

  • El código en el ARNm es traducido, construyendo las largas cadenas de aminoácidos que forman una proteína.

  • 5. La proteína se organiza en su forma funcional.

    Los pasos de la Ingeniería Genética

  • Identificar un carácter deseable, pero que no pueda ser manejado por los métodos clásicos de mejoramiento.

  • Encontrar algún organismo que lo exprese.

  • Encontrar el gen responsable del carácter deseado, en dicho organismo.

  • Combinar dicho gen con otros elementos necesarios para que este sea funcional en la planta.

  • Mover los genes a las células de la planta.

  • Encontrar la células modificadas exitosamente, y regenerarlas en plantas completamente funcionales.

  • Posibilidades de la Biotecnología

    (ejemplos)


    Caracteres de Protección:

    Resistencia a Insectos
    Tolerancia a Herbicidas
    Resistencia a Hongos
    Resistencia a Virus
    Resistencia a Bacterias
    Resistencia a Nematodos


    Caracteres de Calidad:

    Demora de la maduración
    Aceites modificados
    Proteínas modificadas
    Alto contenido de sólidos
    Producción vegetal de anticuerpos, enzimas, etc.

    Búsqueda de fuentes para genes deseados

    (ejemplos)

  • La bacteria de suelo, Bacillus thuringiensis (Bt), tiene genes para diversas proteínas, selectivamente toxicas para ciertos insectos.

  • El actinomycete de suelo, Streptomyces tiene un gen para una enzima que desdobla la molécula del Glufosinato de Amonio (herbicida)

  • Una línea mutante de Arabidopsis thaliana, tiene un gen para una versión de la enzima EPSPS, menos sensible al Glifosato.

  • Herramientas Básicas:

    Enzimas "para cortar y pegar"

    1. Las enzimas de restricción cortan ADN, solo en ciertas secuencias especificas.

    2. Muchas dejan "extremos pegajosos", de manera que otras piezas cortadas con la misma enzima, se ligan automáticamente.

    3. El "extremo pegajoso" de una pieza puede hibridar con el de otra pieza, cortada por la misma enzima.

    4. Otras enzimas llamadas ligasas, terminan las uniones.

    Clonado

  • Además de su principal cromosoma, muchas bacterias tienen también pequeñas piezas circulares de ADN, llamadas plásmidos. Estos tienen a menudo, genes de resistencia a antibióticos.

  • Los plásmidos son fáciles de manejar en tubos de ensayo, para "cortar y pegar" nuevas piezas de ADN

  • 3. Los plásmidos modificados, pueden ser colocados de nuevo en la bacteria, y serán copiados en cada duplicación celular.

    4. De esta forma es posible obtener un gran numero de copias del gen, tan solo incrementando la bacteria.

    Capturando el Gen

    Tomar la pieza de ADN buscada desde el organismo donante

    1. Se extrae ADN de muchas células, y se corta en pequeñas piezas.

    2. Las piezas se mezclan con plásmidos cortados con la misma enzima, las cuales al conjugarse conforman distintos plásmidos.

  • Los plásmidos, colocados de nuevo en bacterias, son ahora distintos, y entonces pueden ser separados.

  • Ahora, cada pieza de ADN puede copiarse tanto como sea necesario.

  • Encontrando el Gen correcto

    1. Los plásmidos usados en la bacteria (vectores clonados), también contienen un gen de resistencia a antibióticos, de manera que solo aquellas que tengan el nuevo plásmido recombinante, crecerán en el medio de cultivo. Este gen se llama "marcador selectivo".

    2. Cada clon (progenie de bacterias con la nueva secuencia de ADN), puede ser probada para saber si contiene el gen deseado. Hay diversas maneras, dependiendo del carácter en cuestión.

    Lo que acompaña al Gen:


    La construcción


    1. Los genes deben "estar prendidos" para expresarse; para eso se usa el promotor.
    2. El ARNm debe ser modificado para salir del núcleo, con los terminadores.

    3. Es necesario saber cuales (poco frecuentes) células han sido modificadas; para eso se agrega un gen marcador selectivo.

    4. La combinación terminada del gen + promotor + marcador selectivo + terminadores, se llama construcción o inserto.

    Promotores: dónde se "prenderá" el gen?

    1. Para que el ADN transcriba el gen en ARNm, debe haber un promotor delante de la secuencia.

    2. Algunos promotores activan el gen en casi todas las células de la planta (Pr. Constitutivos).

    3. Algunos solo lo hacen en las partes verdes.

    4. Otros promotores solo trabajan en tejidos específicos, como polen, raíz o tejidos dañados.

    Marcadores Selectivos

    1. El tipo mas común es el de un gen que codifica para una enzima, que desdobla algún antibiótico o componente del herbicida.

    2. El gen marcador también necesita un promotor y terminador.

    nptll -------------->kanamicína
    bar -->glufosinato de amonio

    3. Normalmente la planta moriría ante el químico. Solamente sobrevivirá si ha sido exitosamente modificada para poseer esta enzima.

    Transfiriendo los genes a las plantas. Opciones de Transformación.

    Métodos

  • Agrobacterium. Uso de una bacteria como "Ingeniero Genético Natural". La bacteria conteniendo el inserto, infecta las células de la planta produciendo la recombinación genética.

  • Acelerador de Partículas (Gene Gun). Un cañón artificial bombardea micropartículas con el inserto, sobre la célula.

  • Electroporación. Uso de carga eléctrica para que el ADN atraviese la membrana nuclear. La corriente, fuerza el paso de los insertos al interior del núcleo.
    4. Polietilenglicol. La exposición de las membranas al PEG, facilita el movimiento de las moléculas de ADN.

  • Silicon Wiskers. Inyección mediante fibras microscópicas. Las fibras atraviesan las membranas, llevando los insertos.

  • Transformación por Agrobacterium:

    Fundamentos

    1. El patógeno de suelo Agrobacterium tumefaciens, naturalmente inserta su ADN (plásmido Ti), en las células expuestas de sus huéspedes, en tejidos radiculares dañados.

    2. Este ADN extraño se incorpora y recombina con el ADN propio de la planta huésped, dividiéndose y creciendo al azar, como un tumor.

    3. El ADN de Agrobacterium toma el control de las células del tumor, causando la síntesis de aminoácidos inusuales que sirven de soporte nutricional a la bacteria.

    Preparando un gen para una transformación mediante Agrobacterium

    1. Las secuencias del plásmido Ti, responsable de la virulencia de la bacteria, se remueven (vírgenes).

    2.En otra bacteria, se ubica el gen deseable, entre las dos secuencias de borde del plásmido Ti.

    3. Se integra el inserto que contiene el gen deseable, dentro del plásmido Ti, al ser incorporado nuevamente dentro del Agrobacterium.

    4. Bacteria clonada, lista para transformar.

    Resumen:


    Transformación mediante Agrobacterium

    1. Armar dos construcciones; una con los genes a incorporar (gen principal y marcador), y otra con las secuencias necesarias del plásmido Ti.

    2. Integrar todo esto en un solo plásmido, en Agrobacterium, y usar este clon para infectar tejido vegetal.

    3. Exponer el tejido tratado al agente químico selectivo (antibiótico o herbicida). Solo las células exitosamente transformadas, sobrevivirán.

    4. Usar métodos de cultivo de tejidos para regenerar plantas viables de las pocas células sobrevivientes.

    Transformación por Acelerador de Partículas (Gene Gun)

    1. Incorporar el inserto en un plásmido y hacer un gran numero de copias en una bacteria.

    2. Extraer los plásmidos y cubrir con ellos pequeñas partículas de tungsteno (1 micrón).

    3. Disparar las partículas mediante una explosión, sobre los tejidos.

    4. Exponer las células al agente selectivo para regenerar aquellas exitosamente transformadas.

    Porque un evento de transformación es raro y costoso?


    1. En todo el proceso hay muchos pasos "poco probables" involucrados, debido a los siguientes obstáculos:

    • Tener que introducir ADN en células vivas.

    • Lograr que el ADN sea insertado en forma estable, en los propios cromosomas de las células, haciendo viable su replicación.

    • Lograr que esta inserción sea funcional


    2. No hay forma de controlar adonde se ubicara el ADN extraño:

    • Podría no ser funcional, dependiendo del sitio de inserción.

    • Podría afectar o anular la acción de algún gen importante de la planta.

    Los primeros desafíos:

    Tolerancia a Glifosato

    Objetivo: Transformar plantas sensibles en altamente tolerantes, para su aplicación directa.

    Origen: El Glifosato inhibe una enzima vegetal (EPSPS), necesaria para el crecimiento celular

    Intento 1: Adicionar una nueva copia del gen para EPSPS, de petunia, con un promotor fuerte, para aumentar la concentración de EPSPS en la planta, y lograr tolerar mayores dosis de Glifosato.

    Resultado 1: Aun con mas EPSPS, las plantas fueron todavía muy sensibles, como para ser de interés comercial.


    Tolerancia a Glifosato: 2do Intento

    Objetivo: Generar mutantes de algún organismo fácil de cultivar, hasta hallar algún individuo tolerante a Glifosato.

    Intento 2: Un aislamiento de Agrobacterium resulta menos sensible, pero su EPSPS es aun funcional; se la transfiere a plantas TG.

    Resultado2: En soja, ambos mecanismos sumados funcionan adecuadamente, no así en maíz, que requiere trabajo adicional.

    Tolerancia a Glifosato: 3er Intento

    Objetivo: Encontrar un microorganismo que produzca una enzima capaz de detoxificar la molécula de Glifosato (GOX de Achromobacter sp.).

    Intento 3: Juntar los efectos del gen para esta enzima con el gen mutante de EPSPS, en plantas de maíz.

    Resultado 3: Este intento, involucrando ambos genes resulto efectivo, logrando que las plantas estén protegidas por producir EPSPS insensible al herbicida, mas la capacidad de detoxificar parte del mismo.

    Tecnología Bt

    Objetivo: Lograr que la planta produzca su propio insecticida

    Origen: Algunos insectos pueden ser controlados mediante la aplicación de Deltaendotoxinas de Bacillus thuringiensis. Estas toxinas son altamente selectivas e inocuas para el hombre y el ambiente, pero se desdoblan rápidamente cuando están expuestas a la luz ultravioleta.

    Intento 1: Poner el gen completo para la toxina-proteína en la planta, con un fuerte promotor que funcione en todos los tejidos.

    Resultado 1: Aun con una transformación exitosa, la planta no producía suficiente proteína para protegerse a si misma.

    Tecnología Bt: 2do Intento

    Origen: Cuando la toxina natural (potoxina) entra en el intestino del insecto, se desdobla en la toxina activa, de cadena mas corta, por acción de las enzimas del insecto.

    Intento 2: Insertar un gen truncado que solo codifique para la porción de la proteína correspondiente a la toxina activa

    Resultado 2: La planta produce mucho mas toxina ahora, pero seria conveniente aun mas.

    Tecnología Bt: 3er Intento

    Origen: La planta "prefiere" usar ciertos codones para algunos aminoácidos. Cuando no tiene estos codones "preferidos" produce mucha menos proteína. Muchos de los codones en un gen bacterial, no son los "preferidos", por lo tanto el gen no se expresa bien en la planta.

    Intento 3: Realizar cambios en el ADN del gen, base por base, de manera que codifique para los mismos aminoácidos, pero usando los codones "preferidos".


    Original TTAGCACCCTAGGCTAGCGTA
    Modificada TTACCACCCTACGCTAGCCTA


    Resultado 3: Cuando el gen es trucado y además tiene los codones "preferidos", expresa suficiente toxina para su autoprotección.

    Genética

    Cromosoma, en citología, nombre que recibe una diminuta estructura filiforme formada por ácidos nucleicos y proteínas presente en todas las células vegetales y animales. El cromosoma contiene el ácido nucleico, ADN, que se divide en pequeñas unidades llamadas genes. Éstos determinan las características hereditarias de la célula u organismo. Las células de los individuos de una especie determinada suelen tener un número fijo de cromosomas, que en las plantas y animales superiores se presentan por pares. El ser humano tiene 23 pares de cromosomas. En estos organismos, las células reproductoras tienen por lo general sólo la mitad de los cromosomas presentes en las corporales o somáticas. Durante la fecundación, el espermatozoide y el óvulo se unen y reconstruyen en el nuevo organismo la disposición por pares de los cromosomas; la mitad de estos cromosomas procede de un parental, y la otra mitad del otro. Es posible alterar el número de cromosomas de forma artificial, sobre todo en las plantas, donde se forman múltiplos del número de cromosomas normal mediante tratamiento con colchicina.

    QUÉ ENTENDEMOS POR "GENÉTICA"

    La genética es una ciencia, y por lo tanto como tal, implica "un conocimiento cierto de las cosas por sus principios y sus causas". Entonces... ¿cuáles son estas cosas que como ciencia la genética estudia?, pues, la "Herencía Biológica", y la "Variación". Y, sus principios y causas, son las "leyes y principios" que gobiernan las "semejanzas" y "diferencias" entre los individuos de una misma "especie".

    Trataremos de desglosar la definición de genética de manera aclaratoria, y así ir subiendo uno por uno los peldaños que nos conducen a una mayor complejidad dentro de la misma, que es la "manipulación". Ante todo, es necesario dejar por sentado un concepto tan claro, como sencillo, pero es el que da pie, para luego derivarse en otros tantos conceptos. AI hablar de las características atinentes

    a toda materia viva, se dice que, "todo ser vivo nace de otro semejante a él", o sea, que posee "caracteres" semejantes a los de su progenitor. Y ¿qué entendemos pues, por "caracteres "? Se trata de cada peculiaridad, cada rasgo, ya sea, morfológico (de forma), funcional, bioquímico (algunos autores incluyen los rasgos psicológicos también) que presenta un individuo biológico.

    Y estos "caracteres" o características lo hacen pertenecer a una misma "especie". ("Especie", es un término que, según el Diccionario de la Real Academia Española, se refiere "al conjunto de cosas semejantes entre sí, por tener una o varios caracteres comunes entre sí").

    Hasta ahora todo apunta, a que la genética estudia los caracteres semejantes que se transmiten de padres a hijos, aquéllos que los hacen parecer entre sí. Pero sucede que también presentan aquellos caracteres que no son semejantes, que varían, y a los cuales dentro de esta ciencia se los denomina "variaciones", y que también son transmitidos genéticamente, o son influenciados por el medio ambiente, al cual se lo denomina "Paratipo".

    Lo que aún sigue oscuro dentro de esta definición, es cómo se transmiten de una generación a otra, estos "caracteres" y estas "variaciones": aquí es donde aparecería el concepto de "gen", término del cual deriva el nombre de esta apasionante ciencia, que es la genética.

    ¿QUÉ ES UN GEN?

    ¿DE QUÉ ESTÁ CONFORMADO?,

    ¿DÓNDE SE ENCUENTRA?,

    ¿CÓMO SE TRANSMITE DE PADRES A HIJOS?

    Las respuestas a estas preguntas, se irán encadenando de tal manera que darán como conclusión, la formación de un ser vivo, un individuo biológico.

    Todos los individuos están formados por unidades microscópicas que se agrupan formando tejidos. Estas unidades (células) poseen dentro de sí, un núcleo; es decir, una estructura diferenciada dentro de la célula. En el interior del núcleo se halla una macromolécula (una sustancia química, de la cual hablaremos más adelante) que es la encargada de la información genética.

    Llamamos "gen", entonces, a las distintas porciones de esta macromolécula que se ocupan, cada una de ellas, de una característica hereditaria determinada. Aunque la obtención de una característica determinada (por ejemplo, el color de los ojos) es más compleja, y depende de la interacción del material genético con el citoplasma celular, con el medio ambiente (Paratipo), y también de la interacción con otros genes.

    El conjunto de genes heredados es lo que se denomina "Genotipo". El "Genotipo" provee

    la información necesaria para la producción de diversos rasgos; luego éstos se ven influidos por el medio ambiente, y esto dependerá de la vida de cada individuo (por ejemplo, una determinada contextura muscular, se verá más o menos desarrollada de acuerdo con la actividad de cada individuo). De esta interacción con el medio ambiente resulta lo que llamamos "Fenotipo" que es aquello que se aprecia

    sensorialmente del individuo.

    Dijimos que el "gen", estaba compuesto por una macromolécula, el ácido desoxirribonucleico, que se encuentra formado por dos cadenas unidas entre sí, y enrrolladas en una espiral.

    CIENCIAS DE LA NATURALEZA

    En 1866, un padre agustino aficionado a la botánica llamado Gregorio Mendel publicó los resultados de unas investigaciones que había realizado pacientemente en el jardín de su convento durante más de diez años. Éstas consistían en cruzar distintas variedades de guisantes y comprobar cómo se transmitían algunas de sus características a la generación siguiente.

    Su sistema de experimentación tuvo éxito debido a su gran sencillez, ya que se dedicó a cruzar plantas que sólo diferían en una característica externa que, además, era fácilmente detectable. Por" ejemplo, cruzó plantas de semillas verdes con plantas de semillas amarillas, plantas con tallo largo con otras de tallo corto, etc.

    Mendel intuyó que existía un factor en el organismo que determinaba cada una de

    estas características. según él, este factor debía estar formado por dos elementos,

    Lino que se heredaba del organismo masculino y el otro del elemento. Además estos dos elementos consistirían en versiones iguales o diferentes del mismo carácter; cada ,tensión del factor proporcionaría, por ejemplo, un color distinto a la semilla o una longitud de tallo diferente en la planta. Además, tal y como veremos más adelante, algunas, versiones serían dominantes respecto a otras. Actualmente a estos factores se les denomina genes, palabra derivada de un término griego que significa «generar», y a cada versión diferente del gen se la denomina alelo. Así el gen que determina, por" ejemplo, el color de la semilla en la planta del guisante puede tener " dos alelos, uno para las semillas verdes y otro para las semillas amarillas.

    Observando los resultados de cruzamientos sistemáticos, Mendel elaboró una teoría general sobre la herencia, conocida como leyes de Mendel.

    Primera ley de Mendel

    Si se cruzan dos razas puras para un determinado carácter, los descendientes de la primera generación son todos iguales entre sí y, a su vez, iguales a uno de sus progenitores, que es el poseedor del alelo dominante. Mendel elaboró este principio al observar que si cruzaba dos razas puras de plantas del guisante, una de semillas amarillas y otra de semillas verdes, la descendencia que obtenía, a la que él denominaba F1, consistía únicamente en plantas que producían semillas de color amarillo. Estas plantas debían tener, en el gen que determina el color de la semilla, los dos alelos que habían heredado de sus progenitores, un alelo para el color verde y otro para el color amarillo; pero, por alguna razón, sólo se manifestaba este último, por lo que se lo denominó alelo dominante, mientras que al primero se le llamó alelo recesivo.

    Segunda ley de Mendel

    Los alelos recesivos que, al cruzar dos razas puras, no se manifiestan en la primera generación (denominada F1), reaparecen en la segunda generacion (denominada F2) resultante de cruzar los individuos de la primera. Ademas la proporción en la que aparecen es de 1 a 3 respecto a los alelos dominantes. Mendel cruzó entre sí los guisantes de semillas amarillas obtenidos en la primera generación del experimento anterior. Cuando clasificó la descendencia resultante, observó que aproximadamente tres cuartas partes tenían semillas de color amarillo y la cuarta parte restante tenía las semillas de color verde. Es decir, que el carácter « semilla de color verde », que no había aparecido en ninguna planta de la primera generación, sí que aparecía en la segunda aunque en menor proporcion que el carácter « semilla de color amarillo »

    Tercera ley de mendel

    Los caracteres que se heredan son independientes entre si y se combinan al azar al pasar a la descendencia, manifestandose en la segunda generacion filial o F2. En este caso, Mendel selecciono para el cruzamiento plantas que diferian en dos caracteristicas, por ejemplo, el color de los guisantes (verdes o amarillos) y su superficie (lisa o arrugada). Observo que la primera generaci6n estaba compuesta unicamente por plantas con guisantes amarillos y lisos, cumpliendose la primera ley. En la segunda generaci6n, sin embargo, aparecian todas las posibles combinaciones de caracteres, aunque en las proporciones siguientes: 1/16 parte de guisantes verdes y rugosos, 3/16 de verdes y lisos, 3/16 de amarilios y rugosos y por ultimo 9/16 de amarillos y lisos. Esto le indujo a pensar que los genes eran estructuras independientes unas de otras y, por lo tanto, que unicamente dependia del azar la combinaci6n de los mismos que pudiese aparecer en la descendencia.

    La Genetica despues de Mendel: Teoria Cromosomica de la herencia

    A principios de este siglo, cuando las tecnicas para el estudio de la celula ya estaban suficientemente desarrolladas, se pudo determinar que los genes estaban formados por acido desoxirribonucleico (ADN) y ademas se encontraban dentro de unas estructuras que aparecian en el citoplasma justo antes de cada proceso de divisi6n celular. A estas estructuras se las denomin6 cromosomas, termino que significa « cuerpos coloreados », por la intensidad con la que fijaban determinados colorantes al ser teñidos para poder observarlos al microscopio. Ademas se vio que estos aparecian repetidos en la celula formando un numero determinado de parejas de cromosomas homologos caracteristico de cada especie, uno de los cuales se heredaba del padre y el otro de la madre. Tambien se pudo comprobar que el numero de pares de cromosomas no dependia de la complejidad del ser vivo. Asi por ejemplo, en el hombre se contabilizaron 23 pares de cromosomas, mientras que en una planta como el trigo podian encontrarse hasta 28 pares.

    En base a estos descubrimientos y a los estudios realizados en 1906 por el zoologo estadounidense Thomas H. Morgan sobre los cromosomas de la mosca del vinagre (Drosophila melanogaster), se pudo elaborar la teoria cromos6mica de la herencia donde se establecia de manera inequívoca la localizac16n fisica de los genes en la celula. Gracias a esta teoria se pudo dar tambien una explicaci6n definitiva a los casos en los que no se cumplian con exactitud las leyes de Mendel anteriormente citadas.

    De manera parecida a Mendel, Morgan se dedic6 a cruzar de manera sistematica diferentes variedades de moscas del vinagre. Estas moscas ofrecian muchas ventajas con respecto a los guisantes ya que tienen un ciclo vital muy corto, producen una gran descendencia, son faciles de cultivar, tienen tan s6lo cuatro cromosomas y presentan caracteristicas hereditarias facilmente observables, como el color de los ojos, la presencia o ausencia de alas, etcetera.

    Herencia de genes ligados

    La investigacion con las moscas del vinagre proporcionó a Morgan evidencias de que los caracteres no eran heredados siempre de forma independiente tal y como habia postulado Mendel en su tercera ley. Supuso que al haber solo cuatro cromosomas diferentes, muchos genes debian estar «ligados», es decir, debian compartir el mismo cromosoma y por ello mostrar una Clara tendencia a transmitirse juntos a la descendencia. No obstante, las conclusiones realizadas por Mendel años atras, no dejaban de ser correctas para los genes «no ligados». Solo la casualidad hizo que Mendel escogiese para los cruces de sus plantas caracteristicas determinadas por genes situados en cromosomas distintos.

    Herencia ligada al sexo

    En uno de sus primeros experimentos, Morgan cruzó un macho de moscas de ojos rojos (normales) con una hembra que habia encontrado casualmente y que tenia los ojos blancos. Las moscas que obtuvo en esta primera generacion o F1 tenian todas los ojos rojos, tal y como se describe en la primera ley de Mendel. Pero cuando cruzó entre si estas moscas para obtener la segunda generación filial o F2, descubrió que los ojos blancos solo aparecian en las moscas macho y ademas como un caracter recesivo. Por alguna razón, la caracteristica «ojos blancos» no era transmitida a las moscas hembras, incumpliendo, al menos parcialmente, la segunda ley de Mendel. Al mismo tiempo, en sus observaciones al microscopio, Morgan habia advertido con extrañeza que entre los cuatro pares de cromosomas de los machos, habia una pareja en la que los cromosomas homólogos no tenian exactamente la misma forma. Era como si a uno de ellos le faltase un trozo, por lo que a partir de ese momento a esta pareja se la denomin6 cromosomas XY. Sin embargo en la hembra, la misma pareja de cromosomas homólogos no presentaba ninguna diferencia entre ellos, por lo que se la denominó cromosomas XX. Morgan pensó que los resultados anómalos del cruzamiento anterior se debian a que el gen que determinaba el color de los ojos se encontraba en la porción que faltaba en el cromosoma Y del macho.

    Por tanto, en el caso de las hembras (xx) al existir dos alelos, aunque uno de ellos fuese el recesivo (ojos blancos), el carácter manifestado era el normal (ojos rojos). En los machos, sin embargo, al disponer Únicamente de un alelo (el de su único cromosoma X), el carácter recesivo si que podia ser observado. De esta manera quedaba tambien establecido que el sexo se heredaba como un carácter más del organismo.

    La era de la genética

    Desde que su padre murió de cáncer de colon hace seis meses, William Panati, un empresario de Illinois, Estados Unidos, no logra conciliar el sueño. Y es que su bisabuelo, la abuela y el hermano fueron víctimas del tumor. Nada pudieron hacer los médicos para salvar a sus familiares.

    La semilla del cáncer de colon se trasmite de padres a hijos, generación tras generación, y unas veces germina y otras permanece latente toda la vida.

    Toda su materia gris ronda en torno a una maldita palabra:

    Cáncer.

    Es entonces cuando oye que ciertos investigadores han desarrollado una prueba sanguínea para detectar el gen que provoca la aparición del cáncer de colon. En pocos días los resultados confirman que Panati y sus tres hijas están a salvo del gen.

    Panati es uno de los primeros beneficiados de uno de los avances mas revolucionarios de la medicina en los últimos tiempos: los marcadores genéticos, pedazos de ADN capaces de rastrear el material genético en busca de genes destartalados.

    Esta nueva tecnología - comenta el doctor Jon Beckwith, del Departamento de Microbiología y Genética Molecular de la Escuela Medica de Harvard, Massachusetts se esta permitiendo a los médicos la identificación de individuos que podrán padecer enfermedades genéticas a lo largo de su vida, o que, estando sanos, portan genes defectuosos.

    No hace menos de 25 años los especialistas, a la hora de enfrentarse a una enfermedad de origen genético, no podían hacer casi nada. La medicina estaba desarmada.

    Tan solo se conocía el numero de cromosomas en humanos, su localización en el interior del núcleo y la situación de algunos genes dispersos.

    Por ejemplo, el medico recibía a una pareja temerosa de volver a tener un hijo con el síndrome de Tay Sachs - una enfermedad cuyos síntomas son la ceguera y la parálisis seis meses después del nacimiento, que conducen a la muerte del niño antes de los cinco años - o afectado de miopatía de Duchenne, una atrofia muscular que deja a los enfermos postrados para siempre en una silla de ruedas.

    Ante esta situación el medico podía únicamente hablar de probabilidades, de los riesgos de que se manifieste o no el gen fatal. Bien poco.

    Sin embargo, hoy la ciencia esta empezando a intervenir en los cromosomas, a detectar los genes dañados mediante avisadores químicos, a darles caza con trampas moleculares y a reemplazarlos por otros en perfecto estado, valiéndose de pinzas enzimáticas. Antes estos espectaculares resultados, no es de extrañar que

    muchos científicos afirmen que estamos en la Era de la Genética.

    La aventura de la ciencia daba comienzo en la primavera de 1953, cuando James Watson, que estaba de visita en la Universidad de Harvard, y Francis Crick, que trabajaba en Cambridge, descubrieron - sin realizar un solo experimento - la estructura del ADN, el acidodesoxirribonucleico. Mientras Crick terminaba su tesis doctoral, Watson, encerrado en su laboratorio, construía modelos de hojalata y alambre, para representar de forma tridimensional las complejas uniones entre los átomos.

    Con los químicos norteamericanos Pauling y Corey pisándoles los talones, Watson y Crick partieron de unas fotografías del ADN obtenidas por rayos x, y la utilizaron para descubrir que la molécula de ADN esta formada por una doble hélice, es decir, dos largos hilos perfectamente enrollados. Cada hilo se constituye a partir de una secuencia de bases nucleicas, cuatro en concreto - adenina ( A ), guanina ( G ), citosina ( C ) y timina ( T ) -, que representan las letras moleculares del mensaje genético.

    Por último, Crick comprobó que, combinando series de tres bases - AGC, AGT, ATA -, lo que se conoce con el nombre de tripletes, se podían obtener más de veinte alternativas distintas, las claves para sintetizar los veinte aminoácidos esenciales para la vida.

    Treinta y siete años más tarde, los científicos están empezando a descubrir que en esta hélice se encuentran escritos los secretos de la vida, el envejecimiento, la muerte y enfermedades como el cáncer, los trastornos del corazón, la locura, la depresión, el mongolismo o las malformaciones genéticas.

    Ahora sabemos, gracias al desarrollo de la biología molecular, que en los casi dos metros de ADN que se guarda en el núcleo de toda y cada una de las células del cuerpo están los 50.000 a 100.000 genes que dan las órdenes para edificar ladrillo a ladrillo, nuestro cuerpo.

    Cada gen tiene una posición determinada y fija en el cromosoma. Lo mismo da que sea el cromosoma de un aborigen australiano, el de un indio del Amazonas o un yuppy de Manhattan. Y cuando los errores aparecen, lo hacen para todos igual. Así, por ejemplo, el mongolismo, también conocido con el nombre de trisomía del cromosoma 21 o síndrome de Down, tiene el mismo origen genético para todos los seres humanos: Un cromosoma de más.

    Ya en 1909 el médico ingles Archibald Garrold se percató de que algunos rasgos hereditarios se correspondían con enfermedades metabólicas, que se caracterizaban por la ausencia de una reacción bioquímica conocida.

    Garrold propuso que tales trastornos, a los que denomino errores innatos del metabolismo, se debían a la ausencia de la enzima que mediaba la reacción. Este es el caso de la enfermedad conocida como fenilcetonuria o idiotez fenilpiruvica, en la que el aminoácido fenilalanina no puede transformarse en otro aminoácido similar, la tirosína.

    Este pequeño lapsus enzimático se traduce en la acumulación en sangre de una sustancia tóxica, la fenilpiruvato, que en los bebes causa un retraso mental.

    Así, si nos detenemos a pensar que un gen sano dirige la síntesis de una proteína sana y juega un papel concreto en el buen funcionamiento del organismo, comprenderemos entonces que si el gen en cuestión presentara un grave defecto, este puede repercutir en la salud de la proteína. ¿ Cómo ? Pues muy sencillo: impidiendo que se fabrique o que, de lo contrario, presente una anomalía en su estructura que le impida ejercer su trabajo.

    Si hemos dicho que existe entre 50.000 y 100.000 genes, esto quiere decir, en potencia, habrá el mismo número de trastornos genéticos.

    Los médicos conocen en la actualidad alrededor de 3.500 enfermedades relacionadas con un patrimonio genético imperfecto, y han logrado aislar unos 1.800 genes implicados en la aparición de estos males. Pero, en estos momentos, más de 10.000 investigadores en todo

    el mundo están rastreando el genoma humano, en busca de nuevos genes. Algunos frutos ya se han recogido. En marzo de este año, un grupo de científicos de la universidad de California en Los Angeles ( UCLA ), en colaboración con otro equipo del Centro de Ciencias de la Salud de la Universidad de Texas en San Antonio, descubrieron una pieza de ADN que contribuye a la aparición del cáncer de colon.

    En abril, Ernest P. Noble, de la UCLA, y Kenneth Blum, de la Universidad de Texas en San Antonio, conmocionaron al mundo de la medicina, al anunciar que habían dado caza a un gen en el cromosoma 11, que estaría implicado con algunas formas de alcoholismo.

    En julio, un grupo de investigadores británicos del Fondo Imperial para la Investigación del Cáncer y del Consejo de Investigación Médica hacían público el hallazgo del gen que determina el sexo masculino, en una pequeña región del cromosoma sexual Y. Cuando se activa en el embrión, el gen pone en marcha los

    mecanismos para la formación de los testículos, marcando el sexo definitivo del futuro bebe.

    También en ese mismo mes, un grupo de científicos norteamericanos de la Facultad de Medicina John Hopkins, de Baltimore, descubrieron cuatro mutaciones genéticas que parecen ser responsables del siete por ciento de los casos de fibrosis quística o mucoviscosidosis.

    Este último avance científico viene a sumarse al descubrimiento de Francis S Collins, de la Universidad de Michigan, y Lap - Chee Tsui, del hospital para niños enfermos de Toronto, Canadá del gen de la mucoviscosidosis en uno de los brazos del cromosoma 7, en septiembre del año pasado. Y en el último número de la revista especializada Journal of National Cáncer Institute, un equipo de científicos norteamericanos ha manifestado la posibilidad de un origen gen tico para el cáncer de pulmón.

    Parece ser que las sorpresas gen ticas no van a decrecer ni por un instante.

    El año pasado, el Instituto Nacional de la Salud y el Departamento de Energía norteamericano, respaldado por el gobiernos de otros países, pusieron en marcha uno de los proyectos mas ambiciosos en la historia de la biología, empresa que ha sido comparada con el proyecto espacial Apolo. Nos referimos al Proyecto Genoma de EE.UU. en el que se han invertido 3.000 millones de dólares para los próximos quince años. Su objetivo: secuenciar el mensaje gen tico del ser humano, es decir, determinar ordenadamente la cadena de 3.000 millones de bases que forman la molécula de ADN.

    En el centro del asunto est Watson " Ciertamente es un esfuerzo muy caro, pero las recompensas del mapa gen tico ser n inimaginables", vaticina Watson.

    Sin embargo, los obstáculos técnicos son importantes. Para hacernos una idea de la magnitud de este proyecto podemos comparar el contenido del ADN con el de la Enciclopedia Británica. Imaginemos que despedazamos en trocitos los tomos de esta enciclopedia y los lanzamos al aire.

    ¿ Se atrevería a recomponer los miles de páginas desmenuzadas?. Seguro que no.

    Un investigador que decidiera por si solo completar el rompecabezas, letra por letra, necesitaría vivir ­ 60.000 años ­.

    Pues bien, los biólogos solo han descifrado hasta ahora menos de una centésima parte del mensaje escrito en la molécula; es decir, que no han completado ni siquiera un tomo.

    Sin la ayuda de las supercomputadoras, el Proyecto Genoma sería una utopía. Para codificar el interminable rosario de letra, se necesitan potentes sistemas informáticos y computadores del calibre del Gray-2.

    Cuando la última letra del ADN sea leída, Watson espera que la medicina del siglo XXI sufra una auténtica revolución, en la que se d el salto definitivo del tratamiento a la prevención de enfermedades.

    Algunas compañías farmacéuticas han incorporado programas y desarrollado pruebas para diagnosticar taras gen ticas, incluso antes del nacimiento.

    Hoy los médicos pueden tratar a pacientes en el momento en que aparecen los primeros síntomas de una enfermedad.

    En el futuro, los especialistas tendrán a su disposición las armas para identificar los genes que podrían causar algún serio problema en el paciente en cualquier etapa de la vida, y de esta manera sacar ventaja y adelantar soluciones.

    Los fumadores, generalmente, padecen serios problemas respiratorios.

    Uno de ellos es el enfisema, patología que se caracteriza por la progresiva destrucción de los alveolos y que llega a interrumpir el intercambio gaseoso.

    Pero parece que cuando el enfisema se presenta prematuramente se debe a un defecto gen tico conocido con el nombre de deficiencia alfa-l-antitripsina.

    La ausencia de esta proteína en la sangre facilita que una enzima liberada por los glóbulos blancos destruya el tejido pulmonar.

    En el 95 por ciento de los casos un gen mutado es el responsable.

    En el caso del enfisema, aunque las células del hígado siguen produciendo la alfa-l-antitripsina, Sta. presenta un aminoácido de menos.

    Los científicos han conseguido aislar y clonar el gen de la alfa-l-antitripsina, para que se fabrique in vitro Pero ¿ como es posible detectar un gen concreto dentro del gran laberinto gen tico y acusarlo de que es el culpable de una enfermedad concreta ?. La tarea no es nada sencilla. Puesto que trabajar con la molécula de ADN entera es del todo imposible, el genetista necesita romperla en pedazos manejables.

    Pero no puede fracturar el ADN al azar, sino de forma inteligente, utilizando unas tijeras moleculares - llamadas enzimas de restricción -, que cortan el ADN por puntos muy concretos, los puntos de restricción.

    Gracias a estas tijeras se pueden obtener fragmentos de ADN con una longitud determinada, medida que difiere de un individuo a otro. Aquí es donde est clave de éxito: en la diferencia. A estos fragmentos marcadores se los denomina Restriction Fragment Lenght Polymorphism o RFLP.

    Se trata del último grito en biotecnolog¡a.

    Cada RFLP se corresponde con un punto exacto dentro del cromosoma del que se ha extraído.

    La idea consiste en encontrar los RFLP que presenten un gran numero de variaciones, para luego utilizarlos en el estudio de familias que padecen una determinada tara gen tica. De esta forma se puede desentrañar si los miembros que padecen la enfermedad llevan consecuentemente una variante particular en sus fragmentos de restricción.

    Si es as¡, los investigadores pueden concluir que el gen de la enfermedad y el RFLP est n ligados: son heredados juntos y por consiguiente pueden ser localizados uno muy cerca del otro.

    Esta compleja técnica ha sido la que ha permitido desenmascarar el gen de la mucoviscosidosis, la maníaco - depresión y la esquizofrenia, entre muchas otras.

    En noviembre de 1987, Janice Egeland, de la Universidad de Miami, y sus colaboradores anunciaron que habían ligado casos de maníaco - depresión en un buen numero de familias Amish con marcadores RFLP en el cromosoma 11.

    Los Amish son una comunidad granjera establecida en el estado de Pensilvania, Estados Unidos, cuyos miembros viven aislados del resto de la sociedad. David Houseman, del Instituto Tecnológico de Massachusetts, que junto a Daniela Gerhard, de la Universidad de Washington en Saint Louis, confirmaron la relación genetica.

    A fines de 1988, estallo la segunda bomba, Hugh Gurling y sus colegas, del University College and Middlesex School of Medicine, en Londres, publicaron en la revista Nature el descubrimiento del gen de la esquizofrenia " Tenemos un marcador que revela que el gen defectuoso de la esquizofrenia se halla oculto en el brazo largo del cromosoma 5 ", declaro Gurling. Inmediatamente un segundo grupo de investigadores de la Universidad de Yale en New Haven, Connecticut, encabezado por Kenneth Kidd, saliendo en su contra, afirmando que en sus investigaciones no habían no habían encontrado tal relación.

    La polémica est en el aire.

    Una vez que los expertos han sido capaces de identificar, aislar y clonar genes a su antojo, el siguiente gran paso de la gen tica es, sin lugar a dudas, la terapia genetica.

    Si un gen est alterado ¿ por qué no sustituirlo por otro que funcione correctamente?.

    En marzo de 1989, los investigadores norteamericanos Steve Rosenber y Michael Blease, del Intituto Nacional del Cáncer, y French Anderson, del Instituto Nacional del Corazón, Pulmón y Sangre, anunciaron su intención de llevar a cabo un intercambio de genes entre seres humanos, concretamente en enfermos terminales del cáncer.

    Los genes trasplantados no habían sido diseñados para tratar a los pacientes, sino para que actuaran como marcadores de las células que les fueron inyectados, concretamente unos linfocitos asesinos llamados infiltradores de tumores, encargados de aniquilar las células cancerígenas.

    Las víctimas del cáncer murieron, pero la transferencia fue un éxito.

    " Nosotros queremos conseguir para nuestros pacientes lo que no pueden alcanzar por si solos ", dice Blease, una autoridad en una enfermedad gen tica llamada deficiencia en adenosindesaminasa o ADA.

    Se trata de una enfermedad neurológica letal que afecta a los recién nacidos y que est asociada a problemas de agresividad, automutilación y a la destrucción de los riñones.

    La pasada primavera, Blease junto a un equipo de colabores propuso al Instituto Nacional de la Salud la transfusión del gen para esta proteína en sus pacientes de ADA. De autorizarse, esta sería la primera terapia gen tica en la historia de la medicina.

    Otras aplicaciones que se pueden desprender del conocimiento del genoma humano no resultan menos apasionantes, como son las prueba de paternidad y la búsqueda de criminales.

    Hace seis años Cetus Corp descubrió una técnica mediante la que se podían obtener millones de copias de un trozo de ADN de forma sencilla y rapida.

    Desde 1987, esta tecnología, conocida como ampliación enzimática del ADN o PCR ( Polymerase Chain Reaction ), ha sido requerida por la policía norteamericana en mas de un millar de crímenes, para identificar al culpable por el rastro biológico- semen, saliva, pelos ... - que deja junto a la víctima.

    Pero volviendo a las enfermedades gen ticas, la meta de los genetistas en los próximos años es la de dar caza a los genes implicados en la diabetes, la enfermedad de Alzheimer, la hipertensión, la obesidad, el cáncer y el SIDA.

    Habrá que estar muy atentos.

    Enfermedades y Genes

    Con la ayuda de las sondas gen ticas, los médicos ya pueden rastrear el ADN en busca de genes defectuosos, responsables de una infinidad de males.

    Parte de estos genes han sido desenmascarados, aislados y clonados.

    He aquí algunos junto a las enfermedades que desencadenan.

    Hemofilia:

    Deficiencia del proceso normal de coagulación sanguínea.

    Est causada por la ausencia de una proteína coagulante.

    El gen fue aislado y clonado en 1984.

    Alcoholismo:

    En marzo de 1990, investigadores de Utah, EE.UU., anunciaban que un gen localizado en el cromosoma 11 podría estar implicado en el desarrollo de este mal.

    Corea de Huntington:

    Trastornos neurológicos, como perdida de memoria y movimientos incontrolados.

    El gen se halla en el cromosoma 4.

    Anemia Falciforme:

    Mal causado por la fabricación de hemoglobina defectuosa, incapaz de transportar el oxigeno en la sangre.

    El gen mutante fue aislado en 1980.

    Mucoviscosidosis:

    O fibrosis quística.

    Gen anómalo encontrado en el año 1990 en el cromosoma 7.

    Afecta a miles de niños, ocasionándoles trastornos respiratorios y digestivos.

    Hipotiroidismo Congénito

    Afecta aproximadamente a unos 80 niños en Chile, provocando retraso mental profundo si no es detectado antes de los seis meses.

    Determinante del Sexo:

    En julio de 1991, biólogos británicos anunciaban que el sexo del embrión viene determinado por la activación de un gen hallado en el cromosoma masculino Y.

    Retraso Mental del X - Frágil :

    Se trata de la causa hereditaria m s frecuente de retraso mental.

    Se caracteriza por una especie de ruptura de uno de los brazos del cromosoma X.

    Se esta buscando el gen correspondiente.

    Miopatia de Duchenne:

    Atrofia muscular que aparece hacia los dos años de edad y desemboca en una parálisis total.

    Maníaco - Depresión:

    También llamada enfermedad bipolar, afecta a un 2 por ciento de la población.

    El gen responsable fue localizado en 1987, en el cromosoma 11.

    Esquizofrenia:

    Afecta al 1 por ciento de la población.

    En 1989 psiquiatras de la Universidad de Londres encontraron el gen de la locura en una región del cromosoma 5.

    Síndrome de Lesch Nyhan

    Ceguera y parálisis.

    Aparece con una frecuencia de 1 en 3000 en las poblaciones judías originarias en Europa Central.

    El gen clonado en 1980.

    Deficiencia de ADA

    Existen 100 casos declarados en el mundo, la terapia genetica a punto para corregir el gen.

    Malformaciones Congénitas

    El riesgo de una embarazada tenga un hijo con una malformación gen tica en el nacimiento es del cuatro por ciento.

    Entre los casos m s comunes se destacan:

    Hidrocefalia:

    Tamaño desmesurado de la cabeza debido a la acumulación excesiva de liquido en el interior del cráneo.

    Microcefalia:

    Cabeza pequeña y generalmente deforme, ocasionada por un subdesarrollo de la caja craneal.

    Labio Leporino:

    Presencia en el recién nacido de una gran hendidura en el labio.

    Ano Imperfecto:

    Deformidad conocida también como imperforación. El bebe nace sin ano.

    Espina Bífida:

    Defecto del tubo neural que consiste en una anomalía en el cierre de uno o más vértebras.

    Genética Moderna

    Actualmente los importantes avances producidos en las tecnicas de investigación cientifica han permitido resolver gran parte de las incógnitas que, durante mucho tiempo, han permanecido sin respuesta en el campo de la genética.

    Entre los progresos más importantes podemos citar el descubrimiento de la estructura en doble hélice del ADN, efectuado en 1953 por los biólogos Watson y Crick, descubrimiento que sentó las bases de la moderna biología molecular. Dentro ya de este campo y en años recientes, se ha conseguido dilucidar el mecanismo por el cual se interpreta la informaci6n contenida en el ADN. El contenido de esta información se ha visto que depende del orden en el que se disponen los distintos tipos de acidos nucleicos para forrnar las cadenas de ADN. Esta secuencia es leida del mismo modo que se leen las distintas letras del alfabeto que componen una palabra, y se interpretan según un conjunto de reglas válidas para todos los seres vivos y descubiertas muy recientemente, que reciben el nombre de código genético. Mediante un proceso denominado transcripción,

    esta secuencia es copiada con exactitud en una molécula de ADN y transportada a los ribosomas del citoplasma. En estos organúlos la información se traduce mediante un complejo proceso denominado biosintesis proteica por el cual se originan las complejas proteinas que componen la materia viva.

    Otros progresos importantes realizados en el campo de la genética son: el descubrimiento de las mutaciones y su influencia en los seres vivos; el origen de las enfermedades hereditarias y su posible curación; la elaboración de mapas cromosómicos describiendo exactamente la información genética de algunos organismos; la posibilidad de manipular dicha información artificialmente mediante la ingenieria genética, etcetera. Los

    avances producidos en este último campo son de tal magnitud que sus aplicaciones están planteando numerosos problemas desde el punto de vista ético, a causa de las importantes repercusiones que puede llegar a tener sobre el futuro de la especie humana.

    BIOTECNOLOGÍA, CIENCIA Y TECNICA PARA EL FUTURO

    Las biotecnologías consisten en la utilización de bacterias, levaduras y células animales en cultivo, cuyo metabolismo y capacidad de biosíntesis son orientados hacia la fabricación de sustancias específicas. Las biotecnologías permiten, gracias a la aplicación integrada de los conocimiento y las técnicas de la bioquímica, la microbiología y la ingeniería química aprovechar en el plano tecnológico las propie-

    dades de los microorganismos y los cultivos celulares. Permiten producir a partir de recursos renovables y disponibles en abundancia gran número de sustancias y compuestos.

    Aplicadas a escala industrial las tales biotecnologías constituyen la bioindustria, la cual comprende las actividades de la industria química: síntesis de sustancias aromáticas saborizantes, materias plásticas, productos para la industria textil; en el campo energético la producción de etanol, metanol, biogas e hidrógeno; en la biomineralurgia la extracción de minerales. Además en algunas actividades cum-

    plen una función motriz esencial: industria alimentaria (producción masiva de levaduras, algas y bacterias con miras al suministro de proteínas, aminoácidos, vitaminas y enzimas); producción agrícola (donación y selección de variedades a partir de cultivos de células y tejidos, especies vegetales y animales transgénicas, producción de bioinsecticidas); industria farmacéutica (vacunas, síntesis de hormonas, interferones y antibióticos); protección del medio ambiente (tratamiento de aguas servi-

    das, transformación de deshechos domésticos, degradación de residuos peligrosos y fabricación de compuestos biodegradables).

    Los procesos biotecnológicos más recientes se basan en las técnicas de recombinación genética así como en el empleo de enzimas y células inmovilizadas. Las moléculas de "ADN recombinado" son elaboradas fuera de las células vivas, uniendo segmentos de ADN natural o sintético a moléculas de ADN que pue-

    den replicarse luego en una célula viva. El principio consiste en reunir un ADN "nativo" y un ADN "extraño" en un vector y, a continuación, introducir el vector en una célula huésped donde podrá multiplicarse. La población así obtenida constituye un clon de "células transformadas" que pueden expresar el mensaje genético extraño que han incorporado y por ende, producir proteínas específicas

    en gran cantidad. Entre otras ya se sintetizan en bacterias -la célula huésped- proteínas de

    gran valor económico como la insulina, la hormona del crecimiento y los interferones.

    MANIPULACIÓN GENÉTICA

    Antes de adentrarnos en el tema de la "manipulación genética", hace falta una introducción, para aclarar una serie de cuestiones y así también realizar una trayectoria hasta llegar a la "manipulación", la cual es en realidad uno de los últimos peldaños que en la actualidad, se desprende de la genética como ciencia.

    Quizá, luego de tomar conocimiento de algunas nociones elementales, podamos percibir que ciertas cuestiones, que desde hace un tiempo atrás pululan en las historias de ciencia ficción, ya no nos resultan tan descabelladas, ni tan ficcionales, sino que podrían ser un atisbo hacia una ciencia que se proyecta al futuro; con actualidad, que tiene sus raíces históricas en un pasado no tan lejano; allá por el año 1865, cuando un monje agustino, llamado Gregor Mendel, profesor de historia natural y física, presentaba un informe con sus descubrimientos, ante la Sociedad Científica de Brun. En ese momento acababan de nacer las bases de la genética.

    La manipulación genética es "la introducción de genes extraños en una célula"; siendo esta célula generalmente un embrión; o sea el producto del huevo fecundado. Recuérdese que se llama "huevo" o "cigoto"; cuando la célula sexual femenina, el óvulo, es fecundado por la célula sexual masculina, el espermatozoide. La fecundación se realiza en el aparato genital femenino, más específicamente, en las trompas uterinas (en el ser humano, se produce en la parte superior de las trompas). Este nuevo huevo o cigoto no tiene al principio, un solo núcleo, sino dos, uno es el pronúcleo del espermatozoide, y otro, es el pronúcleo del óvulo que lo conformaron (luego éstos se unirán para formar el núcleo del huevo). Dicho huevo se extrae del aparato genital, y fuera del mismo, se le introduce material genético, que son fragmentos de A.D.N. contenidos en los genes. El lugar específico donde se realiza esta inoculación es, en el pronúcleo masculino del huevo. Al introducir material genético extraño, se pretende producir

    nuevos caracteres hereditarios que no estaban en el material genético original.

    Es importante aclarar que es éste el único estadio de la vida animal en el que un mensaje genético extraño, puede ser aceptado. Estos huevos con material genético extraño incorporado, reciben el nombre de "huevos manípulados", habiéndose realizado, como dijimos, esta serie de maniobras, en el exterior del aparato genital, luego de lo cual, se lo vuelve a reimplantar en el útero de la hembra.

    Esta técnica se realiza mayormente en mamíferos, más específicamente, en ratones, ya que tienen mayor aceptación para someterse a este tipo de "manipulaciones".

    Se piensa que las "manipulaciones" abrirían un camino para la creación de nuevas especies, con un rendimiento mejor o con una crianza menos costosa; y por otro lado, servirían para el reforzamiento, en una especie determinada, de ciertos caracteres, ampliando el campo de la Biología experimental, más precisamente, de la Biología Molecular.

    Otros de los beneficios en que esto redituaría, podría ser, la importancia del estudio de algunos aspectos del desarrollo embrionario, que hasta la actualidad se desconocen.

    Ingeniería genética , método que modifica las características hereditarias de un organismo en un sentido predeterminado mediante la alteración de su material genético. Suele utilizarse para conseguir que determinados microorganismos como bacterias o virus, aumenten la síntesis de compuestos, formen compuestos nuevos, o se adapten a medios diferentes. Otras aplicaciones de esta técnica, también denominada técnica de ADN recombinante, incluye la terapia génica, la aportación de un gen funcionante a una persona que sufre una anomalía genética o que padece enfermedades como síndrome de inmunodeficiencia adquirida (SIDA) o cáncer.

    La ingeniería genética consiste en la manipulación del ácido desoxirribonucleico, o ADN. En este proceso son muy importantes las llamadas enzimas de restricción producidas por varias especies bacterianas. Las enzimas de restricción son capaces de reconocer una secuencia determinada de la cadena de unidades químicas (bases de nucleótidos) que forman la molécula de ADN, y romperla en dicha localización. Los fragmentos de ADN así obtenidos se pueden unir utilizando otras enzimas llamadas ligasas. Por lo tanto, las enzimas de restricción y las ligasas permiten romper y reunir de nuevo los fragmentos de ADN. También son importantes en la manipulación del ADN los llamados vectores, partes de ADN que se pueden autorreplicar (generar copias de ellos mismos) con independencia del ADN de la célula huésped donde crecen. Estos vectores permiten obtener múltiples copias de un fragmento específico de ADN, lo que hace de ellos un recurso útil para producir cantidades suficientes de material con el que trabajar. El proceso de transformación de un fragmento de ADN en un vector se denomina clonación, ya que se producen copias múltiples de un fragmento específico de ADN. Otra forma de obtener muchas copias idénticas de una parte determinada de ADN es la reacción de la polimerasa en cadena, de reciente descubrimiento. Este método es rápido y evita la clonación de ADN en un vector.

    Terapia génica

    La terapia génica consiste en la aportación de un gen funcionante a las células que carecen de esta función, con el fin de corregir una alteración genética o enfermedad adquirida. La terapia génica se divide en dos categorías. La primera es la alteración de las células germinales, es decir espermatozoides u óvulos, lo que origina un cambio permanente de todo el organismo y generaciones posteriores. Esta terapia génica de la línea germinal no se considera en los seres humanos por razones éticas. El segundo tipo de terapia génica, terapia somática celular, es análoga a un trasplante de órgano. En este caso, uno o más tejidos específicos son objeto, mediante tratamiento directo o extirpación del tejido, de la adición de un gen o genes terapéuticos en el laboratorio, junto a la reposición de las células tratadas en el paciente. Se han iniciado diversos ensayos clínicos de terapia genética somática celular destinados al tratamiento de cánceres o enfermedades sanguíneas, hepáticas, o pulmonares.

    Beneficios

    La ingeniería genética tiene un gran potencial. Por ejemplo, el gen para la insulina, que por lo general sólo se encuentra en los animales superiores, se puede ahora introducir en células bacterianas mediante un plásmido o vector. Después la bacteria puede reproducirse en grandes cantidades constituyendo una fuente abundante de la llamada insulina recombinante a un precio relativamente bajo. La producción de insulina recombinante no depende del, en ocasiones, variable suministro de tejido pancreático animal. Otra aplicación importante de la ingeniería genética es la fabricación de factor VIII recombinante, el factor de la coagulación ausente en pacientes con hemofilia. Casi todos los hemofílicos que recibieron factor VIII antes de la mitad de la década de 1980 han contraído el síndrome de inmunodeficiencia adquirida (SIDA) o hepatitis por la contaminación viral de la sangre utilizada para fabricar el producto. Desde entonces se realiza la detección selectiva de la presencia de VIH (virus de la inmunodeficiencia humana) y virus de la hepatitis C en los donantes de sangre, y el proceso de fabricación incluye pasos que inactivan estos virus si estuviesen presentes. La posibilidad de la contaminación viral se elimina por completo con el uso de factor VIII recombinante. Otros usos de la ingeniería genética son el aumento de la resistencia de los cultivos a enfermedades, la producción de compuestos farmacéuticos en la leche de los animales, la elaboración de vacunas, y la alteración de las características del ganado.

    Riesgos

    Mientras que los beneficios potenciales de la ingeniería genética son considerables, también lo son sus riesgos. Por ejemplo, la introducción de genes que producen cáncer en un microorganismo infeccioso común, como el virus influenza, puede ser muy peligrosa. Por consiguiente, en la mayoría de las naciones, los experimentos con ADN recombinante están bajo control estricto, y los que implican el uso de agentes infecciosos sólo se permiten en condiciones muy restringidas. Otro problema es que, a pesar de los rigurosos controles, es posible que se produzca algún efecto imprevisto como resultado de la manipulación genética.

    Ingeniería genética

    1. En ingeniería genética, los científicos utilizan enzimas de restricción para aislar un segmento de ADN que contiene un gen de interés —por ejemplo, el gen que regula la producción de insulina. 2. Un plásmido extraído de su bacteria y tratado con la misma enzima de restricción puede formar un híbrido con estos extremos 'pegajosos' de ADN complementario.3. El plásmido híbrido se reincorpora a la célula bacteriana, donde se replica como parte del ADN celular.4. Se pueden cultivar un gran número de células hijas y obtener sus productos genéticos para el uso humano.

    EL SECRETO DE LA VIDA

    El descubrimiento de todos los genes humanos permitirá curar desde el cáncer hasta el sida. Pero podría abrir la puerta a la discriminación.

    El nuevo milenio no se iniciará en el 2000, como todos creen, sino en el 2005. Es que ese arlo culminará el 'Proyecto Genoma Humano", considerado el mayor desafio cientifico de todoslos tiempos o -cuanto menos- el más espectacular desde el 'Proyecto Manhattan ". Después de 15 años de búsqueda frenética, los científicos de todo el mundo enrolados en el Proyecto habrán descubierto todos y cada una de ios jeroglíficos inscriptos en nuestros 100.000 genes, es decir, habrán descifrado el génoma humano.

    La biblia biológica del Moma sapiens estará en ese momento lista para ser hojeada de adelante para atrás, al derecho y del revés. Cual quiera podrá convertirse entonces en un hereje, modificando la letra de la naturaleza. Para bien o para mal.

    CLONACION

    Obtener seres humanos Idénticos ya esta tecnicamente posible. Tal vez pueda fabricarse en el futuro un individuo desde cero en el laboratorio.

    Que es el PGH

    • El Proyecto Genoma Humano se inició en 1990 en los Estados Unidos y se extendió bájo la sigla Hugo) a laboratorios moleculares de todo el mundo.

    • Se lo compara con el Proyecto Manhattan, por el desafio enorme que implica y las nuevas tecnologías que originará en el campo de la biologia y de la informática (almacenamiento y procesamien to de miles de millones de datos)

    Dentro del ácido desoxiribonucleico (ADN) que compone los genes, se encuentran las instrucciones para fabricar cada proteína del organismo. Esto significa que la llave maestra para poner en funcionamiento -o sacar de circulación- una célula o un órgano está en los genes. "Claro que esas órdenes sólo constituyen el 3 % del ADN de las células. El 97 % restante es una incógnita", apunta George Cohen (75)., jefe de Biologia Molecular del instituto Pasteur, en París.

    Una vez que los científicos tengan en sus manos el libro completo de la vida, las instrucciones genéticas podrán ser decodificadas, reparadas o reformuladas. Antes o después del nacimiento de un individuo.

    "El Proyecto Genoma Humano será el punto de partida de una nueva biologia", anticipa Mariano Levin (44), investigador del instituto de Genética y Biología Molecular (INGEBI). "Asistiremos a una violenta aceleración del conocimiento y entraremos de lleno en la era de la revolución genomica, que influirá profundamente en todos los aspectos de la vida", se entusiasma el cientifico argentino que lidera el proyecto para estudiar el genoma del parásito que causa el Mal de Chagas.

    "El nacimento de la medicina molecular preventiva permitirá evitar los efectos de mutaciones genéticas y abrirá caminos para curarlas", revela Levin. Muchas de las 4000 enfermedades hereditarias encontrarán, por fin, la oportunidad del olvido. El reemplazo de genes dañados por sanos servirá para tratar incluso infecciones y cánceres (ver recuadro).

    Riesgo. Claro que, al abrir esta caja de Pandora, también podrán escapar pesadillas. La eugenesia, que promueve la selección de los individuos

    Candidatas al Service

    • Sida

    • Distrofia muscular

    • Corea de Hunlington

    • Diabetes

    • Fibrosis quistica

    • Hemofilia

    • Tumores cerebrales

    "mejores" y la eliminación de los considerados "peores" surgió en Inglaterra hace dos siglos y tuvo su remake durante el nazismo. En el futuro, cuando el catálogo completo delos genes circule por la superautopista informática. ¿quién se resistirá a la tentación de producir un niño perfecto, con un pequeño toquecito en los genes que controlan la Inteligencia, la estatura, el color del cabello...?

    Elegir el sexo de un niño; eliminar las "taras" de un puñado de individuos; negar atención médica a quienes porten anomalías; y dar empleo únicamente a los que no tienen perspectivas genéticas de enfermar ; todas estas alternativas figurarán algún día en los estantes de los burócratas.

    A Medida. Sonia entrará al Inmaculado hospital sin mirar a los costados. Se Dirigirá al consultorio de ter-

    cera edad y abrirá la puerta.

    - "Quiero un bebé de piel clara, ojos verdes, 3 kilos, con un coeficiente intelectual superior a la media y altura suficiente para jugar al básquet", solicitará a la recepcionista.

    Nueve meses después -la gestación todavía será un trámite aconsejable, aunque no imprescindible-, el sonro-

    sado producto de una exacta combinación de óvulo y espermatozoide mamará de sus turgentes pechos, conservados en su mejor forma gracias a un cocktail de hormonas.

    Después de una carrera de ejecutiva top, Sonia sonreirá satisfecha. Se dirá a si misma que un niño con sus

    propios genes, corregidos y mejorados, era el único deseo que le faltaba concretar. Y hacerlo a los 65 años

    habrá sido la mejor decisión de su vida.

    Mapas. Uno de los objetivos del PGH es encontrar la localización exacta de cada gen en los cromosomas.

    Catalogo. La fantasía parece hoy Irreal, ya que nadie ha logrado todavía introducir o manipular con precision un gen dentro de una célula de un embrión para producir en él un rasgo determinado. Con todo, la Inexistencia de un método que permita acometer estos malabarismos genéticos hoy y la improbabilidad de que una técnica tan sofisticada se consiga mañana - no implica que en un futuro lejano no se puedan diseñar niños a medida del propio deseo.

    Lo único cierto es que si el gigantesco proyecto que hoy transcurre casi

    inadvertido en laboratorios moleculares del mundo llega a buen fin, los científicos tendrán ante sus ojos la lista perfectamente ordenada delos 3 mil millones de pares de letras (bases químicas ) que constituyen los genes humanos, junto con el mapa de su localización en los cromosomas.

    "La finalización del Proyecto Genoma Humano (PGH) será en realidad el comienzo de una empresa aún

    más importante: entender qué hacen y cómo interactúan las proteínas producidas según las órdenes de cada uno de esos genes", dice Daniel Goldstein (56), profesor de Biología en la UBA y en la Universidad de Harvard. "Se podrán diseñar racionalmente drogas para actuar sobre una proteína alterada o utilizar a los mismos genes como fármacos".

    Los biomédicos teclearán su password e ingresarán sin mayores obstáculos al programa que contiene las claves para arreglar casi cualquier defecto orgánico. ¿Cuál es el maldito gen responsable de que la piel lozana se transforme en eso tan parecido a una naranja, conocido como celulitis? ¿Qué gen hay que "encender para que un niño aprecie las matemáticas? Las respuestas a éstas y otras preguntas vendrán en forma de comprimidos, inyecciones y células transformadas en el laboratorio. Las genes serán las medicamentos del futuro.

    Juegos. Al conocer el orden y la combinación en que se ubican los cuatro ladrillos químicos -guanina, adenina, citosina, timina- que componen el ADN, los expertos podrán jugar sin problemas al Scrabel celular. Con un simple "sácame de aquí esta timina" o un "hazme el favor de incluir dos guaninas extras en el brazo corto del cromosoma 11", los biotecnólogos del futuro tendrán bajo control la salud y la enfermedad.

    Clones. ¿Se fabricará alguna vez un ejército de clones humanos, perfectamente idénticos en su aspecto fisico y sus aspiraciones psíquicas, como imaginó AIdous Huxley en "Un mundo feliz"? "Se han hecho estos experimentos en ranas o en plantas pero no en seres humanos. Sin embargo, este upo de clonaje no requiere ningún avance de ingenieria genética sino conocimientos de embriología que ya están disponibles", dice Alberto Kornblihtt (41), profesor de Biología Molecular en la UBA.

    "Es posible pensar en fabricar réplicas de un individuo, del mismo modo en que se podría congelar un

    embrión y hacerlo despertar dentro de 200 años", continúa el investigador del INGEBI. "Pero eso no tiene

    nada que ver con el PGH ni con la ingeniería genética. Hoy no estamos más cerca de 'Un mundo feliz' que cuando fue escrito, varias décadas atrás", insiste Korblihtt.

    Por su parte, Goldstein sostiene sin dudar que "no va a existir ningún problema tecnológico para obtener individuos idénticos a partir de una célula somática. También se va a poder sintetizar un individuo desde cero, a partir de sus elementos químicos".

    Ricos Y Famosos. Uno de los grandes interrogantes que plantea el PGH es a quién le pertenecerán los descubrimientos. Hasta poco tiempo atrás, nadie dudaba de que los genes eran patrimonio de la humanidad, y por lo tanto nadie podía adueñarse de ellos. Pero el dinero y la ambición pueden más que otros pruritos. Ya se han presentado solicitudes de patentamiento para miles de pares de porciones de ADN.

    "Las empresas condicionan su apoyo a la investigación a cambio de cierto tipo de propiedad de las secuencias genéticas obtenidas", confesa Mariano Levin. "Tengo la sensación -desliza el consultor en biotecnologia Alberto Díaz (53)- de que no se llegará al patentamiento de las secuencias de genes pero si se patentarán sus posibles usos y aplicaciones".

    Discriminación. El mayor riesgo que generará el PGH es la segregación de los individuos según su perfil genético. En el futuro, la gente portará una tarjeta de identidad que ¿contendrá su nombre y su huella genética. Las compañías aseguradoras se negarán a cubrir a aquéllos que tengan, por ejemplo, una alta probabilidad de desarrollar un cáncer. Los empleadores no tomarán a quienes tengan genes "inconvenientes" para el trabajo, por más que el aspirante no exprese ningún síntoma en ese momento o quizás nunca llegue a enfermar.

    "Poco a poco, se está creando la idea de que tener una mutación genética es sinónimo de enfermedad, y

    ese determinismo es absolutamente falso", insiste Goldstein. En el futuro, la gente se va a querer hacer diagnósticos genéticos para cualquier cosa, y eso les va a traer grandes problemas: desde la angustia de una sentencia que podria o no cumplirse a largo plazo, hasta el despido del trabajo o la marginación.

    "La información genética deberá ser confidencial. Si se hiciera pública o si entrara en las bases de datos de las empresas, provocaría todo tipo de discriminaciones", dice Kornblihtt.

    Según George Cohen, es imprescindible continuar creando comités de bioética y discutir leyes regulato-

    rias. "La única vacuna para evitar un mal uso de la ciencia -concluye Levin- es educar éticamente a los cientificos e informar a la gente".

    ¿Quién tiene derecho a conocer nuestros secretos biológicos ?

    Atrapado por los genes

    La salud es el más preciado de los bienes, y también el más íntimo. Pero, ¿podemos estar seguros de que el médico va a mantener en secreto todo lo que le contamos?

    John Mayfield y Joseph Vlacovsky eran dos marines ejemplares. Jamás habían desobedecido una orden, pues en su corta carrera militar aprendieron lo que significaba la obediencia en uno de los cuerpos más duros del mundo. Sin embargo, a mediados del año pasado se atrevieron a decir "no, señor :se negaron a cumplir un mandato. El acontecimiento sucedió cuando sus superiores los requirieron para hacerles una prueba de ADN. El registro de la huella genética es obligatorio para todos los soldados en los Estados Unidos desde 1992. Los dos marines se enfrentan ahora a un juicio en la Corte Suprema militar. El Ejército esgrime que las pruebas de ADN son indispensables para la identificación de los soldados caídos en combate. Los afectados piensan que se ha violado un derecho a la intimidad ¿Quién tiene razón?

    En la Argentina no hay una legislación al respecto. Sin embargo, hay profesionales, como la doctora Susana Turyk, presidenta de la Sociedad Argentina de Genética, que opinan que todo aspecto que involucre a la genética tiene que estar dentro del marco de la legalidad, pero también dentro del marco ético como en toda práctica médica. En cualquier caso, se supone que todos los datos obtenidos de nuestro ADN son considerados exclusivamente médicos y no pueden utilizarse para otro fin que no sea la salud del afectado o la investigación medica pero existen algunos matices que, a menudo, dan lugar a la ambigüedad.

    Vacío Legal :

    Pocos países reconocen en su legislación el tráfico de huellas genéticas o las nuevas tecnologías de simulación informática del ADN.

    Cada ves hay mas persona interesadas en nuestros genes

    El primero es sencillo: las pruebas de ADN pueden ser utilizadas en un juicio o en una investigación policial, por lo que dejan de ser sólo médicas.

    El segundo matiz es más complejo. Según el responsable de la Sección de Bioética del Consejo de Europa, Carlos de Sola, reconoce cuatro grupos de personas que hipotéticamente reclamarían su derecho a acceder a los datos de la herencia de un individuo: "Primero, los miembros de su familia, sobre todo si se trata de su mujer y ésta quiere saber, por ejemplo, si sus futuros hijos son susceptibles a heredar alguna enfermedad.

    Segundo, las personas que tienen una relación económica con el sujeto(especialmente laboral).

    Tercero, la sociedad (por ejemplo, en los trámites para la identificación de un delincuente).

    Cuatro, los investigadores médicos".

    ¿No es demasiada la gente interesada en nuestros genes? Al fin y al cabo, no hay que olvidar que el ADN porta la información más intima del sujeto. Tanto es así, que los, que los datos desprendidos de él puede no conocerlos ni su propio portador.

    Los problemas han empezado a surgir en algunos países, como en los Estados Unidos, por ejemplo, donde ciertas compañías de seguros han exigido conocer la predisposición genética de sus asegurados a sufrir enfermedades, para reconsiderar sus contratos o aumentar las tarifas. En otras ocasiones, algunas empresas pretendieron descarta a aquellos de sus empleados cuyo ADN no fuera recomendable.

    ¿Qué se puede hacer para evitar estos abusos? La doctora Ann Cavoukian, del Comisariado de Protec-

    ción de la Vida Privada del Canadá, invoca un nuevo derecho: La autodeterminación informativa. Para ella, "es esencial garantizar el control sobre la información genética propia. Solamente el portador de los genes tiene derecho a decidir si éstos deben tomarse, utilizarse y revelarse ".

    La salud pública prevalece sobre la privada

    Claro que las cosas no son siempre tan sencillas. ¿Qué pasará cuando la información genética pueda ser necesaria para erradicar una enfermedad de alcance público?

    ¿Qué prevalecerá entonces, el derecho individual o el colectivo?

    Mientras se solventan estas pequeñas deficiencias, algunos expertos en bioética reunidos recientemente por el Journal of he American Medical Association (JAMA) proponen cuatro medidas para garantizar la intimidad. "Un banco de datos de ADN no debe ser usado sin informar públicamente de las intenciones y el impacto futuro de ese uso. No se pueden tomar muestras genéticas sin el consentimiento previo del sujeto afectado, que debe tener siempre acceso a los resultados. Las muestras sólo se pueden utilizar para su fin original y no para otros secundarios. Los individuos cuya información genética sea archivada deberán ser advertidos de cualquier dato que afecte a su salud futura."

    El problema, en cualquier caso. sigue sin estar resuelto y tendrá que pasar mucho tiempo hasta que las leyes aseguren el buen uso de nuestros genes. No se debe perder de vista que la investigación genética aún está en sus albores. Es cierto que, como recuerda Carlos de Sola, "la información sobre el genoma de un individuo representa la más intima expresión de cuantos factores endógenos intervienen en su salud actual y futura. Por ello, debe estar especialmente protegida. Pero también es, verdad que, cuando se complete el mapa genético humano, se podrá tener la llave para curar unas 4.000 enfermedades hereditarias, algunas de ellas muy graves. De ese modo, nuestros genes traspasarían el ámbito de lo intimo y se convertirían en una cuestión de salud pública. ¿Cómo vamos a impedir su conocimiento y uso, entonces? El tiempo resolverá este dilema.

    Hay que guardar el anonimato de los experimentos

    Por el momento, una preocupación más actual y evidente es el uso de otro tipo de datos relacionados con la salud. En concreto, la cantidad de información que un médico recibe de su paciente y queda almacenada en los ficheros clínico. Todo individuo tiene derecho a conocer su historia clínica y a no aplicarse un tratamiento, excepto en los casos en los que prevalece la salud pública: por ejemplo, cuando se detecta una epidemia. En tanto, el expediente de un paciente sólo puede ser conocido por él mismo, por sus médicos y por sus familiares, en ciertos casos. También puede ser utilizado por otros profesionales de la salud para fines de investigación científica. En este último punto lo importante es que el nombre del enfermo se separe totalmente de la investigación. Para ello, pueden utilizarse protocolos de anonimato, como, por ejemplo. Etiquetar con números en lugar de con nombres y guardar estos últimos en sobres cerrados. Es, sin duda, responsabilidad de los hospitales o clínicas disponer las medidas suficientes para que sus historias clínicas estén siempre a buen recaudo.

    De herencia, una gran biblioteca

    La información genética está codificada en largas secuencias de cuatro bases o letras de la vida: adenina, guanina, citosina y timina. Hasta la fecha, se ha leído el ADN completo de virus, bacterias y levadura.

    En la recta final del Proyecto Genoma, los científicos esperan identificar un gen a diario.

    En la tapa del número de MUY que tiene en sus manos aparece un bebé recién nacido junto a un titular que describe una situación casi idílica: "Las enfermedades que nunca tendrá: el diagnóstico precoz y las nuevas terapias génicas anuncian el fin de miles de dolencias hereditarias, incluido el cáncer". Es cierto que el pequeño no padecerá el síndrome de Down, ni el síndrome de frágil x -la causa más frecuente de retraso mental- ni la fibrosis quística o mucoviscidosis -dolencia que afecta a miles de niños, ocasionándoles severos trastornos digestivos y respiratorios- ni corea de Huntington -una enfermedad neurodegenerativa que aparece en edad adulta-. Pero el bebé no las padecerá porque, de lo contrario, probablemente no habría nacido. Sus padres, portadores del gen del Huntington, decidieron concebirlo mediante fertilización in vitro, para someterlo, antes de ser implantado, a una batería de pruebas cromosómicas y análisis genéticos. Afortunadamente, todos dieron negativo.

    "Hasta ahora, la única posibilidad de evitar el alumbramiento de niños con enfermedades genéticas, mal formaciones congénitas o anomalías cromosómicas era la realización de un diagnóstico prenatal mediante amniocentesis o biopsia de corion, técnicas que permiten extraer células embrionarias del seno materno. Si se detecta que el feto porta una alteración severa, en España existe la opción de interrumpir el embarazo", dice el doctor Juan Bernar, responsable del Area de Genética de la unidad FIV y Genética Humana del Hospital Ruber Internacional de Madrid.

    La doctora Susana Turyk, presidenta de la Sociedad Argentina:

    Genética Médica, señala que en ese sentido no sucede lo mismo en nuestro país. Pues la legislación contempla la posibilidad interrumpir el embarazo por causas fetales en los casos en donde peligra la vida de la embarazada o cuando existe un caso de una mujer insana, ejemplo, una mujer que padece una deficiencia mental y que es violada.

    Los embriones con alteraciones genéticas son desechados

    Sin embargo, el moderno diagnóstico preimplantacional hace posible la transferencia al útero de embriones que se ha comprobado que son sanos. Si, por el contrario, los análisis cromosómicos y genéticos ponen en evidencia una anomalía muy grave son desechados, ya que por el momento es imposible de corregir la inmensa mayoría de dolencias genéticas catalogadas hasta la fecha, que superan las 6.000. Las técnicas desarrolladas al abrigo del Proyecto Genoma Humano, el enorme desafío internacional cuyo objetivo es secuenciar o leer los 3.000 millones de bases o letras que integran la molécula dela herencia humana -e1ADN-,han permitido cuadruplicar la tasa descubrimientos de genes humanos. Estas secuencias de ADN que contienen la información necesaria para fabricar proteínas aparecen implicadas en la génesis de enfermedades hereditarias. La hipertensión, el mal de Alzheimer, el Parkinson, la psicosis maníaco-depresiva, dolencias coronarias, la diabetes y otros procesos crónicos, que afectan a más del 10 por ciento de población adulta, tienen un fuerte componente genético.

    La actividad investigadora de los laboratorios y centros de genética es tan frenética que casi a diario hallan un nuevo gen de los entre 100.000 y 150.000 que se encuentran integrados en los cromosomas.

    Sin duda alguna, el ritmo seguirá acelerándose en los próximos años. "Cuando nos aproximemos a la recta final, lo que está previsto que ocurra en los albores del próximo siglo, esperamos que cada hora se secuencia un gen", señala Francis Collins, director del Centro Nacional para la investigación del Genoma Humano, en los Estados Unidos, que hace hincapié en los avances decisivos que se han producido en la última década y, en concreto, a lo largo de 1996.

    Razones no le faltan. A principios de año, el equipo de Jean Weissenbach, de la empresa francesa Genethon y del CNRS, y el de Eric lander, del Instituto Tecnológico de Massachusetts, en los Estados Unidos, presentaron en la revista Nature el primer mapa genético humano que allanaba el camino para la identificación de múltiples genes patógenos. Y, hace poco, la revista Science publicó un atlas actualizado del genoma humano con información acerca de más de 16.000 genes.

    Los expertos navegan por el ADN con la ayuda de mapas

    En líneas generales, un mapa genético consiste en un diagrama que describe las relaciones cromosómicas de miles de secuencias de ADN, conocidas como marcadoras, dependiendo de cómo se separan y recombinan a lo largo de generaciones humanas. En el mapa obtenido por Lander y Weissenbach, las secuencias marcadoras se corresponden con los denominados microsatélites, unos fragmentos genéticos que se repiten a lo largo de la molécula de ADN. Estos diagramas se complementan con los llamados mapas físicos, que no son otra cosa que la representación gráfica de la posición de un gen dentro de un cromosoma.

    Con los dos tipos de mapas es posible encontrar rápidamente el lugar donde se esconden los genes asociados con una enfermedad. De este modo, Graeme Bell y sus colegas de la Universidad de Chicago, en los Estados Unidos, han aislado dos genes -uno en el cromosoma 12 y otro en el 20- implicados en una forma de diabetes hereditaria que afecta a personas jóvenes, según han anunciado en la revista Nature del mes de diciembre.

    Hallado un gen implicado en el cáncer de próstata

    Este hallazgo se produce apenas un mes después de que Patrick Walsh, de la Escuela de Medicina Johns Hopkins, en Baltimore, publicara en Science el descubrimiento en el cromosoma 1 de un gen -e1 HPCI- ligado al cáncer de próstata hereditario, el tumor más frecuente en los varones.

    La localización del HPC1 constituye el primer paso para su identificación. "Lo primero que tenemos que hacer ahora es donar el gen -es decir, obtener muchas copias de él- y secuenciarlo. Esto nos permitirá después saber cómo la mutación de este gen incrementa el riesgo de sufrir este tumor", dice Walsh.

    No menos interesante ha sido el hallazgo de un segundo gen del cáncer de mama y ovario -e1BRCA2- y la identificación por primera vez de un fragmento de ADN implicado en la aparición de la enfermedad de Parkinson, un trastorno degenerativo del sistema nervioso que se manifiesta por la lentitud y escasez de movimientos, temblores y rigidez muscular. Se estima que el 25 por ciento de las personas afectadas por este mal heredan el gen defectuoso, que ha sido detectado en el brazo largo del cromosoma 4, según el investigador Zach Hall, de los institutos Nacionales de la Salud estadounidenses.

    La avalancha de datos acerca de la molécula de la vida parece no tener freno. En los centros de investigación ya se aíslan de forma rutinaria mutaciones genéticas asociadas con la aparición de enfermedades hereditarias. Los genes encontrados son inmediatamente patentados para así, según los científicos, sufragar y estimular las investigaciones y evitar la ocultación de aquellas secuencias de ADN que encierran un valor médico.

    Por su lado, los laboratorios de genética compiten en el desarrollo y la puesta en el mercado de sencillos tests genéticos que detecten en los pacientes la mutación del gen que los predispone a sufrir un determinado mal y a acortarles la esperanza de vida.

    Análisis para males hereditarios como la fibrosis quística, el cáncer de mama, la anemia falciforme, el mal de Alzheimer y el cáncer de colon están siendo desarrollados o ya se utilizan, al menos, en ensayos clínicos.

    Los resultados de los tests son difíciles de interpretar

    La posibilidad de comercialización de algunas de estas pruebas en los Estados Unidos ha suscitado acalorados debates entre genetistas y bioéticos, ya que la interpretación de los resultados es harto imprecisa, como sucede con la del análisis para el gen BRCA1, que está implicado en el cáncer de mama hereditario. Muchas mujeres que saben que son portadoras de una versión alterada del gen, que acarrea un riesgo -no una certeza- del 85 por ciento de padecer el tumor, se han extirpado los pechos.

    Por otro lado, las organizaciones defensoras de los derechos humanos denuncian que no existe un marco legal que garantice la confidencialidad de los resultados y los abusos que se deriven de los resultados de las pruebas: denegación de seguros de vida y sanitarios, rechazo laboral... Esto ya es una realidad, como se demuestra en un trabajo publicado en la revista Science de diciembre por Charira Kozma, de la Universidad de Georgetown, en Washington.

    Genes con dueño

    La mayoría de las patentes de genes humanos han sido presentadas por laboratorios y centros privados, seguidos de las instituciones públicas. Para los de los derechos humanos, la comercialización de secuencias de nuestro ADN es inadmisible.

    Ingeniería Genética

    Definición de Ingeniería Genética

    La Ingeniería Genética (en adelante IG) es una rama de la genética que se concentra en el estudio del ADN, pero con el fin su manipulación. En otras palabras, es la manipulación genética de organismos con un propósito predeterminado.

    En este punto se profundizará el conocimiento sobre los métodos de manipulación génica. El fin con el cual se realizan dichas manipulaciones se tratará más adelante, cuando se analicen los alcances de esta ciencia.

    Enzimas de restricción.

    Como ya se dijo, la IG consiste la manipulación del ADN. En este proceso son muy importantes las llamadas enzimas de restricción, producidas por varias bacterias. Estas enzimas tienen la capacidad de reconocer una secuencia determinada de nucleótidos y extraerla del resto de la cadena. Esta secuencia, que se denomina Restriction Fragment Lenght Polymophism o RLPM, puede volver a colocarse con la ayuda de otra clase de enzimas, las ligasas. Análogamente, la enzima de restricción se convierte en una "tijera de ADN", y la ligasa en el "pegamento". Por lo tanto, es posible quitar un gen de la cadena principal y en su lugar colocar otro.

    Vectores.

    En el proceso de manipulación también son importantes los vectores: partes de ADN que se pueden autorreplicar con independencia del ADN de la célula huésped donde crecen. Estos vectores permiten obtener múltiples copias de un trozo específico de ADN, lo que proporciona una gran cantidad de material fiable con el que trabajar. El proceso de transformación de una porción de ADN en un vector se denomina clonación. Pero el concepto de clonación que "circula" y está en boca de todos es más amplio: se trata de "fabricar", por medios naturales o artificiales, individuos genéticamente idénticos.

    ADN polimerasa.

    Otro método para la producción de réplicas de ADN descubierto recientemente es el de la utilización de la enzima polimerasa. Éste método, que consiste en una verdadera reacción en cadena, es más rápido, fácil de realizar y económico que la técnica de vectores.

    Terapia Génica.

    La terapia génica consiste en la aportación de un gen funcionante a las células que carecen de esta función, con el fin de corregir una alteración genética o enfermedad adquirida. La terapia génica se divide en dos categorías.

  • Alteración de células germinales (espermatozoides u óvulos), lo que origina un cambio permanente de todo el organismo y generaciones posteriores. Esta terapia no se utiliza en seres humanos por cuestiones éticas.

  • Terapia somática celular. Uno o más tejidos son sometidos a la adición de uno o más genes terapéuticos, mediante tratamiento directo o previa extirpación del tejido. Esta técnica se ha utilizado para el tratamiento de cánceres o enfermedades sanguíneas, hepáticas o pulmonares.

  • Aplicaciones

    La Ingeniería genética tiene numerosas aplicaciones en campos muy diversos, que van desde la medicina hasta la industria. Sin embargo, es posible hacer una clasificación bastante simple bajo la cual se contemplan todos los usos existentes de estas técnicas de manipulación genética: aquellos que comprenden la terapia génica, y aquellos que se encuentran bajo el ala de la biotecnología.

    Usos de la terapia génica.

    "En marzo de 1989, los investigadores norteamericanos Steve Rosenber y Michael Blease, del Instituto Nacional del Cáncer, y French Anderson, del Instituto Nacional del Corazón, Pulmón y Sangre, anunciaron su intención de llevar a cabo un intercambio de genes entre seres humanos, concretamente en enfermos terminales de cáncer.

    Los genes trasplantados no habían sido diseñados para tratar a los pacientes, sino para que actuaran como marcadores de las células que les fueron inyectados, unos linfocitos asesinos llamados infiltradores de tumores, encargados de aniquilar las células cancerígenas.

    Las víctimas de cáncer murieron, pero la transferencia había sido un éxito "

    Este fue uno de los primeros intentos de utilizar las técnicas de IG con fines terapéuticos.

    Hoy el desafío de los científicos es, mediante el conocimiento del Genoma Humano, localizar "genes defectuosos", información genética que provoque enfermedades, y cambiarlos por otros sin tales defectos.

    La ventaja quizá más importante de este método es que se podrían identificar en una persona enfermedades potenciales que aún no se hayan manifestado, para o bien reemplazar el gen defectuoso, o iniciar un tratamiento preventivo para atenuar los efectos de la enfermedad. Por ejemplo, se le podría descubrir a una persona totalmente sana un gen que lo pondría en un riesgo de disfunciones cardíacas severas. Si a esa persona se le iniciara un tratamiento preventivo, habría posibilidades de que la enfermedad no llegue nunca.

    A través de una técnica de sondas genéticas, se puede rastrear la cadena de ADN en busca de genes defectuosos, responsables de enfermedades genéticas graves.

    Si bien la información del Genoma Humano fue recientemente descubierta, ya se han localizado los "locus" de varias enfermedades de origen genético. He aquí algunas de ellas:

    Hemofilia - Alcoholismo - Corea de Huntigton - Anemia Falciforme - Fibrosis quística - Hipotiroidismo Congénito - Retraso Mental - Miopatía de Duchenne - Maníacodepresión - Esquizofrenia - Síndrome de Lesch Nyhan - Deficencia de ADA - Hidrocefalia - Microcefalia - Labio Leporino - Ano Imperfecto o Imperforación - Espina Bífida.

    Pero los alcances de la terapia génica no sólo se limitan a enfermedades genéticas, sino también a algunas de origen externo al organismo: virales, bacterianas, protozoicas, etc. En febrero de este año, por ejemplo, se anunció que un grupo de científicos estadounidenses empleó técnicas de terapia génica contra el virus del SIDA. Sintetizaron un gen capaz de detener la multiplicación del virus responsable de la inmunodeficiencia, y lo insertaron en células humanas infectadas. El resultado fue exitoso: el virus detuvo su propagación e incluso aumentó la longevidad de ciertas células de defensa, las CD4.

    Otra técnica peculiar inventada recientemente es la del xenotransplante. Consiste en inocular genes humanos en cerdos para que crezcan con sus órganos compatibles con los humanos, a fin de utilizarlos para transplantes.

    Esto nos demuestra que la Ingeniería Genética aplicada a la medicina podría significar el futuro reemplazo de las técnicas terapéuticas actuales por otras más sofisticadas y con mejores resultados. Sin embargo, la complejidad de estos métodos hace que sea todavía inalcanzable, tanto por causas científicas como económicas.

    Biotecnología.

    Pero el conocimiento de los genes no sólo se limita a la Medicina. La posibilidad de obtener plantas y animales trangénicos con fines comerciales es demasiado tentadora como para no intentarlo.

    Las biotecnologías consisten en la utilización de bacterias, levaduras y células animales en cultivo para la fabricación de sustancias específicas. Permiten, gracias a la aplicación integrada de los conocimientos y técnicas de la bioquímica, la microbiología y la ingeniería química aprovechar en el plano tecnológico las propiedades de los microorganismos y los cultivos celulares. Permiten producir a partir de recursos renovables y disponibles en abundancia gran número de sustancias y compuestos.

    Aplicadas a escala industrial, las tales biotecnologías constituyen la bioindustria, la cual comprende las actividades de la industria química: síntesis de sustancias romáticas saborizantes, materias plásticas, productos para la industria textil; en el campo energético la producción de etanol, metanol, biogas e hisrógeno; en la biomineralurgia la extracción de minerales. Además, en algunas actividades cumplen una función motriz esencial: la industria alimentaria (producción masiva de levaduras, algas y bacterias con miras al suministro de proteínas, aminoácidos, vitaminas y enzimas); producción agrícola (donación y selección de variedades a partir de cultivos de células y tejidos, especies vegetales y animales trangénicas, producción de bioinsecticidas); industria farmacéutica (vacunas, síntesis de hormonas, interferones y antibióticos); protección del medio ambiente (tratamiento de aguas servidas, transformación de deshechos domésticos, degradación de residuos peligrosos y fabricación de compuestos biodegradables).

    Los procesos biotecnológicos más recientes se basan en las técnicas de recombinación genética descritas anteriormente.

    A continuación se detallan las aplicaciones más comunes.

    Industria Farmacéutica.

    Obtención de proteínas de mamíferos.

    Una serie de hormonas como la insulina, la hormona del crecimiento, factores de coagulación, etc. tienen un interés médico y comercial muy grande. Antes, la obtención de estas proteínas se realizaba mediante su extracción directa a partir de tejidos o fluidos corporales.

    En la actualidad, gracias a la tecnología del ADN recombinante, se clonan los genes de ciertas proteínas humanas en microorganismos adecuados para su fabricación comercial. Un ejemplo típico es la producción de insulina que se obtiene a partir de la levadura Sacharomces cerevisae, en la cual se clona el gen de la insulina humana.

    Obtención de vacunas recombinantes.

    El sistema tradicional de obtención de vacunas a partir de microorganismos patógenos inactivos, puede comportar un riesgo potencial.

    Muchas vacunas, como la de la hepatitis B, se obtienen actualmente por IG. Como la mayoría de los factores antigénicos son proteínas lo que se hace es clonar el gen de la proteína correspondiente.

    Agricultura.

    Mediante la ingeniería genética han podido modificarse las características de gran cantidad de plantas para hacerlas más útiles al hombre, son las llamadas plantas transgénicas. Las primeras plantas obtenidas mediante estas técnicas fueron un tipo de tomates, en los que sus frutos tardan en madurar algunas semanas después de haber sido cosechados.

    Recordando que la célula vegetal posee una rígida pared celular, lo primero que hay que hacer es obtener protoplastos.

    Vamos a ver las técnicas de modificación genética en cultivos celulares. Estas células pueden someterse a tratamientos que modifiquen su patrimonio genético. Las técnicas se clasifican en directas e indirectas.

    Entre las técnicas indirectas cabe destacar la transformación de células mediada por Agrobacterium tumefaciens.

    Esta bacteria puede considerarse como el primer ingeniero genético, por su particular mecanismo de acción: es capaz de modificar genéticamente la planta hospedadora, de forma que permite su reproducción. Esta bacteria es una auténtica provocadora de un cáncer en la planta en la que se hospeda.

    Las técnicas directas comprenden la electroporación, microinyección, liposomas y otros métodos químicos.

    Entre los principales caracteres que se han transferido a vegetales o se han ensayado en su transfección, merecen destacarse:

    Resistencia a herbicidas, insectos y enfermedades microbianas.

    Ya se dispone de semillas de algodón, que son insensibles a herbicidas. Para la resistencia a los insectos se utilizan cepas de Bacillus thuringiensis que producen una toxina (toxina - Bt) dañina para las larvas de muchos insectos, de modo que no pueden desarrollarse sobre las plantas transgénicas con este gen. Respecto a los virus se ha demostrado que las plantas transgénicas con el gen de la proteína de la cápsida de un virus, son resistentes a la invasión de dicho virus.

    Incremento del rendimiento fotosintético.

    Para ello se transfieren los genes de la ruta fotosintética de plantas C4 que es más eficiente.

    Mejora en la calidad de los productos agrícolas.

    Tal es el caso de la colza y la soja transgénicas que producen aceites modificados, que no contienen los caracteres indeseables de las plantas comunes.

    Síntesis de productos de interés comercial.

    Existen ya plantas transgénicas que producen anticuerpos animales, interferón, e incluso elementos de un poliéster destinado a la fabricación de plásticos biodegradables

    Asimilación de nitrógeno atmosférico.

    Aunque no hay resultados, se ensaya la transfección del gen nif responsable de la nitrogenasa, existente en microorganismos fijadores de nitrógeno, y que permitiría a las plantas que hospedasen dicho gen, crecer sin necesidad de nitratos o abonos nitrogenados, aumentando la síntesis de proteínas de modo espectacular.

    Proyecto HUGO

    El Proyecto Genoma Humano es una investigación internacional que busca seleccionar un modelo de organismo humano por medio del mapeo de la secuencia de su ADN. Se inició oficialmente en 1990 como un programa de quince años con el que se pretendía registrar los 80.000 genes que codifican la información necesaria para construir y mantener la vida. Los rápidos avances tecnológicos han acelerado los tiempos esperándose que se termine la investigación completa en el 2003.

    Cuando faltan sólo tres años (2003) para el cincuentenario del descubrimiento de la estructura de la doble hélice por parte de Watson & Crick (1953), se ha producido el mapeo casi completo del mismo.

    Los objetivos del Proyecto son:

    • Identificar los aproximadamente 100.000 genes humanos en el ADN.

    • Determinar la secuencia de 3 billones de bases químicas que conforman el ADN.

    • Acumular la información en bases de datos.

    • Desarrollar de modo rápido y eficiente tecnologías de secuenciación.

    • Desarrollar herramientas para análisis de datos.

    • Dirigir las cuestiones éticas, legales y sociales que se derivan del proyecto.

    Relación con la Ingeniería Genética.

    Ya que este proyecto se limita sólo a la información genética del ser humano, las aplicaciones se limitan sólo a la terapia génica, apartando las aplicaciones biotecnológicas.

    El conocimiento del Genoma Humano permitirá identificar y caracterizar los genes que intervienen en las principales enfermedades genéticas, lo que hará posible el tratamiento mediante terapia génica a casi todas las enfermedades que tengan un posible origen genético.

    Opinión personal

    Siempre que los avances científicos y tecnológicos se producen con esta rapidez, el entusiasmo por seguir adelante no deja lugar a una cavilación acerca de los pro y los contras que puede provocar.

    Un caso histórico es la Revolución Industrial. En la vorágine de construir las mejores máquinas, los científicos de la época dejaron de lado el factor contaminación ambiental, ignorando que, un siglo más tarde, el haber utilizado máquinas a vapor inició un proceso prácticamente irreversible de calentamiento global y contaminación atmosférica.

    Otro caso más que clásico es la fórmula de la Teoría de la Relatividad, que abrió camino a dos aplicaciones bien polarizadas y antagónicas: el uso de la medicina atómica para salvar vidas, y la construcción de bombas atómicas para destruirlas.

    Y parece ser que el hombre no aprende de sus errores, porque en el afán de ver "hasta dónde podemos llegar", los genetistas y otros científicos de hoy anuncian día a día orgullosamente sus nuevas hazañas, sin tener en cuenta las consecuencias no sólo ambientales, sino también éticas y morales.

    Casi cada aspecto de la IG presenta una controversia y exige un profundo análisis, de modo que las posibles consecuencias negativas causadas por la negligencia científica se eviten.

    En el caso de la IG orientada al agro, por ejemplo. Las cosechas transgénicas ya son abundantes en el mundo, pero no son testeadas correctamente las posibles consecuencias ecológicas que pudiesen causar. Esto provocó el levantamiento de los organismos ecológicos no gubernamentales, que han elaborado una extensa lista de faltas cometidas por las distintas compañías. Esta acción, a su vez, creo una concepción negativa de los organismos transgénicos. Se lo ve como algo completamente nocivo para la salud, a la vez que se desconoce de qué se trata. Está en el conocimiento popular que cualquier ser, planta o animal, genéticamente modificado es sinónimo de veneno o tóxico. Este miedo irracional fue utilizado por ciertas organizaciones protectoras del medio ambiente para aumentar este temor popular. "Podés estar comiendo plantas con genes de ratas o víboras", fue uno de los argumentos más sensacionalistas.

    Con esto no estoy diciendo que estoy a favor de los organismos transgénicos y en contra de la ecología. Sólo creo que se debe informar mejor a la población acerca de la transgenia, y hacer estudios serios sobre las consecuencias tanto para el ambiente como para el humano, para así poder dar conclusiones científicamente avaladas.

    Cambiando de área, si nos vamos a la IG en enlace con la medicina, el panorama es aún más negro.

    El hecho de que en realidad se haya tenido en cuenta la posibilidad de la eutanasia (busca del perfeccionamiento de la raza humana) indica que, lamentablemente, siguen personas con ideología nazi en el mundo.

    Está patente el miedo de que, en un futuro no tan lejano, cualquier persona con el dinero suficiente y la escasez suficiente de escrúpulos, contrate a algún igualmente inescrupuloso grupo de médicos para obtener descendencia con determinadas características. No es que crea que esto será legal, pero tampoco lo es en la actualidad el aborto, y sin embargo se practica.

    Es por eso que creo que, paralelamente con los descubrimientos y avances que se anuncian día a día, se tendría que legislar competentemente en todos los países. Esto pondría límites morales, éticos y civiles a los científicos, que pocas veces se detienen a considerar las consecuencias de sus actos.

    La ciencia se puede usar tanto para el bien como para el mal. Depende de nosotros el uso que le demos. Sería una lástima que una ciencia tan prometedora como esta fuera desperdiciada para fines inmorales o puramente económicos. Es el deber de los hombres de hoy tomar una decisión fundamental: aprender del pasado histórico del mundo, o seguir caminando a ciegas, con los ojos tapados y sin mirar atrás.

    Resumen:
    Definición de Ingeniería Genética. Técnicas de manipulación genética. ADN recombinante. Terapia Génica. Técnica de la ADN polimerasa. Organismos transgénicos. Biotecnología. Otras aplicaciones de la Ingeniería Genética. El proyecto Genoma Humano y su relación con la Ingeniería Genética. Opinión personal.

    Reflexiones y recomendaciones sobre el uso de organismos manipulados genéticamente.

    Potenciales impactos.

    El uso de organismos manipulados genéticamente en la actividad agropecuaria está muy de moda, por tanto se considera oportuno explicar los siguientes potenciales impactos:

    1- Se desconoce el efecto que puede producir el polen y la miel de plantas transgénicas en la apicultura y la medicina natural. No hace mucho las pruebas de campo realizadas con un virus al que se le había transferido material genético procedente de un escorpión causaron gran alarma en Inglaterra: el experimento no había tenido en cuenta que casualmente la zona era el hábitat de varias especies protegidas de mariposas nocturnas, sensibles al insecticida biológico. También investigadores franceses han descubierto que algunas variedades de la colza transgénica pueden perjudicar a las abejas, el polinizador más efectivo de los cultivos de los agricultores, destruyendo su habilidad natural para reconocer el olor de las flores en el campo.

    2- Ya se dieron problemas con una hormona transgénica (rBST) inyectable en las vacas para aumentar la producción de leche. Esta hormona produce en las vacas mastitis, lo que da lugar a niveles más altos de antibióticos y carcinógenicos (IGF-1) en la leche. También se reportan problemas por la presencia de leche contaminada con una hormona de crecimiento bovina (rBGH). Además de la incidencia de lesiones en pezuñas y patas, dificultades reproductivas, metabólicas e infecciones urinarias y de ubres. Los estudios científicos más preocupantes son los que relacionan el rBGH con el cáncer en humanos.

    3- Se prevé que la utilización de plantas transgénicas tolerantes a herbicidas en la agricultura, podría conllevar por un lado a incrementar el uso de dichos herbicidas en mayores dosis y mayores concentraciones y por otro lado a un desarrollo más rápido de la resistencia de las "malezas" a esos herbicidas. Con esto los productores y/o vendedores de herbicidas estarían garantizando sus productos, pero en detrimento de la Agricultura.

    4- En cuando al desarrollo y uso de plantas transgénicas con resistencia a insectos y enfermedades, se proveen como efectos, cambios estructurales en ecosistemas naturales; la afectación de especies de fauna nativa, y efectos nocivos sobre la salud humana. En razón de que "las plantas procedentes de ingeniería genética tendrán ventajas respecto a las plantas autóctonas (nativas), elevando las probabilidades de que las nuevas plantas invadan los ecosistemas que las rodean y se conviertan ellas mismas en plagas. Las toxinas podrían ser también dañinas para insectos benéficos y aves. Si el cultivo está destinado al consumo humano o animal, también podría este verse afectado por el consumo" (Greenpeace, 1994). También la resistencia permanente que proporcionan las plantas transgénicas, podrían ocasionar resistencia de las plagas a los químicos más rápido de lo conocido actualmente. Si las plagas continuamente están en contacto con el insecticida o Bacilus thuringiensis (Bt) introducido a la planta, la resistencia al insecticida se daría mucho más rápido que hoy en día. En lugar de usar cada vez menos insecticidas se usaría cada vez más, creando resistencia contra Bacilus thuringiensis la industria química pondría en peligro la agricultura.

    5- Se tiene conocimiento que en El Salvador, ya se está trabajando con cultivos de este tipo, como por ejemplo en el Centro Nacional de Tecnología Agropecuaria y Forestal (CENTA), se está experimentando con semilla de algodón transgénica. Sin tener en cuenta que el cultivo del algodonero es de polinización abierta (es decir se cruza libremente en el ambiente), se corre el riesgo de que las plantas transgénicas actúen como un conductos para que los genes "extraños" se transfieran a otras poblaciones de plantas silvestres, dando como resultado una contaminación genética. Algo peligroso es que debido a que los productos Bacillus thuringiensis son "relativamente no tóxicos" comparados con los insecticidas químicos, agricultores y consumidores pudieran no darse cuenta de la necesidad de controlar su uso.

    El cultivo de papa, tomate, tabaco, algodón y maíz modificados genéticamente (incorporado un gen de Bacilus thuringiensis) producen su propio plaguicida para eliminar insectos. Más sin embargo hace poco se encontró en Escocia la primera especie de insecto benéfica con pruebas de daño ocasionadas por plantas transgénicas.

    Los científicos del Instituto Escocés de Investigación Agraria de Dundee, encontraron que los Coccinellidae hembras que comieron áfidos que se alimentaron de la savia de plantas de papa modificadas genéticamente tuvieron una oviposición (huevos puestos) significativamente menor, así mismo, el tiempo de vida fue la mitad del promedio.

    Según algunos científicos los alimentos transgénicos acortan la vida de la gente, en tal sentido algunos doctores aseguran que las sustancias estrógenas desarrolladas en cultivos transgénicos como soya (Roundup) causan problemas de infertilidad en hombres y mujeres (también se menciona que las sustancias estrógenas causan cáncer de mama); lo anteriormente mencionado sumado a los efectos nocivos descubiertos en los insectos benéficos (Coccinellidae), sugiere que los cultivos genéticamente alterados podrían tener consecuencias inesperadas en un futuro. Así pueden concebirse algunas preguntas inquietantes como estas: Qué uso se le dará a la semilla de algodón que proporcionen las plantas transgénicas?, será para uso humano (aceites) o animal (para fabricar concentrados)?. Si se trata del cultivo de hortalizas para consumo fresco, la preocupación es mucho mayor.

    Se han documentado otros problemas como por ejemplo: en 1997 un algodón transgénico diseñado para resistir al herbicida Roundup, dejo caer sus motas en los campos de los granjeros de Mississipi que pagaron para probarlo. En febrero, la compañía comenzó a compensarles por sus pérdidas. Otro tipo de algodón, fue diseñado para mantener controlado al gusano de la bellota mediante la producción de la toxina Bt. Durante un ensayo desarrollado en 1996, las plantas produjeron la toxina, pero no fue suficiente para controlar la plaga de ese año. Algunos granjeros decepcionados no tuvieron más remedio que rociar sus cultivos transgénicos con insecticidas sintéticos.

    Un científico que trabaja para una empresa de biotecnología con sede en Bangalore, alerta sobre los peligros de una contaminación biológica: "Monsanto dice que la propagación del polen del algodón alcanza tan solo 1.5 metros. Tal vez las condiciones de Estados Unidos en las que llegaron a esa cifra sean diferentes, pero en India el polen puede trasladarse hasta 5 kilómetros y contaminar otras plantas". Por tanto en nuestro país no podemos afirmar que el algodón transgénico será seguro mientras no se realicen las investigaciones con datos propios de El Salvador.

    6- También han habido problemas de salud humana trágicos durante 1989-1990, con un producto suplemento alimenticio (L-Triptofano) producido utilizando la ingeniería genética. Treinta y una muertes ocurridas y más de 5,000 personas afectadas por la enfermedad incapacitante de la sangre llamada Síndrome Eosinofilia Mialgia en los Estados Unidos y Europa. La investigación genética indica que muchas enfermedades tienen su origen en minúsculas imperfecciones del Código genético.

    En julio de 1998, Greenpeace dio a conocer los resultados de Patrice Courvalin del Instituto Pasteur de París, sobre el maíz Bt-176. Según las investigación de Courvalin, las semillas de dicho cultivo pueden transmitir resistencia a antibióticos a los seres humanos, tanto por su consumo directo como por el consumo de animales que hayan sido alimentados con este maíz transgénico.

    7- Los organismos transgénicos poseen alta inestabilidad, porque los genes transferidos pueden migrar, mutar sus características, multiplicarse de manera incontrolada, recombinarse en el genoma o ser transferidos a otros organismos. En tal sentido un organismo declarado "seguro" puede tornarse en corto tiempo peligroso, sin que se detecte su nuevo comportamiento por largo tiempo, como por ejemplo: un cultivo transgénico desarrollado en un país del norte, puede causar problemas serios en otros países, ya que las diferentes condiciones ambientales pueden producir en los genes una cascada de cambios impredecibles que pueden causar problemas en la salud humana, la seguridad alimentaría y/o ambiental. Quien asegura que en El Salvador, las plantas transgénicas no causaran problemas, esta mintiendo inconscientemente, debido a que es imposible predecir que va a pasar con un gen una vez que entra en un nuevo huésped y/o en diferentes condiciones ambientales de áreas geográficas distintas. Cualquier predicción puede resultar frustrada debido al dinamismo de las poblaciones naturales.

    8- Con base en las tendencias descritas en la biotecnología podríamos vislumbrar a mediano plazo en los países que las desarrollan una total o casi total "autosubsistencia". Teniendo en cuenta que son las transnacionales de países del Norte las que están a la cabeza de estos desarrollos, podríamos conjeturar la ruptura de los mercados sur-norte. Pero, también en el contexto actual de la globalización, y teniendo en cuenta la agresividad de los mercados de las transnacionales, se podría preveer el flujo de cultivos transgénicos Norte-Sur y finalmente, las nuevas variedades que surjan reemplazaría cultivos tradicionales, acelerando el proceso de erosión genética y agudizando las críticas condiciones socioeconómicas de los países del sur.

    9- La toxina Bt en las plantas transgénicas tiene propiedades diferentes a la toxina Bt en su forma natural. La bacteria Bt contiene una toxina inactiva la cual sólo puede activarse en larvas de insectos específicos del Orden Lepidopera (como por ejemplo: no daña insectos Collembola del Orden Tisanura); situación contraria con el maíz Bt transgénico de Novartis que contiene tres diferentes formas proactivas de la toxina (información aportada junto con la solicitud para comercialización de maíz transgénico a las autoridades competentes de Francia, 1994). Tomando en cuenta que el uso de está tecnología causa mortalidad significativa al insecto Collembola y una reducción importante de la tasa de reproducción de los sobrevivientes, se espera como resultado un empobrecimiento del suelo, ya que dicho insecto transforma la materia vegetal en materia orgánica disponible para las plantas y los microorganismos benéficos del suelo que son de gran importancia en las cadenas alimenticias y en el incremento de la biodiversidad. También el 21 de agosto de 1997 se reportó en Suiza, que larvas de dos de tres especies de crisopa (Orden Neuroptera) considerados insectos benéficos (depredadores de insectos plagas de cultivos), murieron cuando fueron alimentadas con larvas del gusano barrenador europeo, que a su vez se alimentó con maíz transgénico de Novartis. Esto es muy preocupante ya que la toxina puede ser transferida a través de la cadena alimenticia, un efecto que nunca ha sido reportado en la toxina Bt en su forma natural (Greenpeace, septiembre 1999. Revista Biodiversidad sustento y culturas).

    10- La reducción de la biodiversidad (componente fundamental de la agricultura biológica), en razón de que las especies transgénicas tendrían más ventajas competitivas: mayor resistencia a herbicidas, mayor resistencia a insectos y enfermedades, mayor adaptación a las condiciones ambientales y por lo tanto mayores posibilidades de volverse dominantes e invadir comunidades naturales de plantas y animales, y de este modo reducir la biodiversidad natural

    11- Afectación de los ciclos químicos naturales y por ende las funciones de ecosistemas naturales (base indispensable de la agricultura biológica). Los nuevos rasgos conferidos a los organismos transgénicos, podrían ser adaptados a los organismos de tipo silvestre, pudiéndole alterar su biología, incluidas funciones como las vías en las cuáles los microorganismos o plantas participan en los ciclos químicos naturales.

    12- Un riesgo potencial de la utilización de organismos transgénicos en la agricultura, incluye la posibilidad de que algunos nuevos genes podrían pasar a plantas silvestres las cuáles a su vez podrían volverse malezas. Las nuevas malezas podrían tener efectos adversos sobre cultivos locales y/o sobre ecosistemas silvestres.

    13- Otro peligro de la liberación de plantas transgénicas es que las modificaciones que se han introducido pueden ser adquiridas por las "malezas" parientes del cultivo transgénico. Por ejemplo, se conoce muy bien que el zacate Johnson es una especie diferente al Sorghum pero se sabe que puede hibridizar con Sorghum y heredar la resistencia a herbicidas poseída por dicho cultivo.

    14- Un riesgo más de la ingeniería genética sobre la agricultura tiene que ver con el hecho de que los cultivos transgénicos pueden volverse una amenaza para las plantas silvestres y variedades de cultivos tradicionales que son los mayores recursos de la diversidad fitogenética y base de la agricultura biológica. Esta amenaza podría resultar de la competencia de los cultivos transgénicos con plantas silvestres y variedades de cultivos tradicionales y de la transferencia de los nuevos genes de los cultivos transgénicos a las variedades tradicionales o silvestres, vía transferencia de polen.

    15- Un efecto grave es la utilización de un nuevo gen llamado por algunos "terminator" que permitirá que los cultivos que nazcan de las semillas transgénicas tengan la característica de ser estériles. Esto permitiría que los agricultores no les quede más remedio que pagar cualquier precio exigido por la compañía si desean utilizar sus semillas. Peor aún, según algunos escenarios catastrofistas, el material genético de las plantas nacidas de las semillas "terminator" podría diseminarse con el viento o los insectos polinizadores, para luego cruzarse con parientes silvestres y extenderse entre las especies hasta dejar súbita e irreversiblemente esterilizada a la flora nativa emparentada con el cultivo transgénico. (Jeffrey Kluger, 1999).

    16- Un riesgo más, es que los compuestos introducidos en los cultivos transgénicos para resistir hongos o insectos y para inhibir plagas pueden, no intencionalmente, producir también la muerte de hongos e insectos benéficos. Igualmente los cultivos transgénicos usados para la manufactura de drogas o aceites industriales y químicos podrían potencialmente causar daños a los animales, insectos y microorganismos del suelo (Third World Network, 1995).

    17- Manipulaciones genéticas aparentemente inofensivas pueden provocar un desastre ecológico, como se ha demostrado recientemente en el caso de una bacteria (Klebsiella planticola) diseñada para "digerir" los residuos orgánicos de la agricultura intensiva, transformándoles en metano aprovechable como biocombustible y en un residuo utilizable como abono orgánico. Las pruebas experimentales realizadas por expertos en suelos demostraron que su presencia alteraba el equilibrio hongo/bacteria imprescindible para la asimilación de nutrientes por las plantas. De haberse llegado a comercializar a gran escala, como se pretendía, la propagación de esta bacteria en el medio hubiera tenido consecuencias desastrosas.

    18- La posible contaminación química de aguas superficiales y subterráneas (recursos fundamentales de la agricultura biológica) por microorganismos o plantas con procesos inusuales o acelerados.

    19- Algo muy grave es que algunos rasgos de los organismos transgénicos pueden tomar décadas o muy largo tiempo para manifestarse. Un organismo declarado "seguro" puede tornarse en corto tiempo peligroso, sin que se detecte su nuevo comportamiento por largo tiempo.

    20- En general las plantas transgénicas contienen partes de virus, en estado de volverse un virus resistente. Algunos científicos afirman que existe la posibilidad de que en general, el uso de plantas resistentes a virus, en la agricultura pueda conducir a nuevos filtros de virus o a incrementar los riesgos de nuevas enfermedades virales con efectos adversos sobre los cultivos.

    21- Precios altos de las semillas transgénicas producen otro riesgo, debido a que los pequeños campesinos o agricultores no podrían comprar esas semillas manipuladas costosas.

    22- Plantas resistentes a un cierto herbicida, tiene que ser tratadas exclusivamente con este químico; el agricultor se ve obligado a comprar semillas más herbicida como paquete. Gran ventaja para el industrial es que así deja a la competencia de lado y asegura la venta de su producto químico.

    23- El enfoque un gen-una plaga ha sido superada fácilmente por las plagas, las cuales se adaptan continuamente a nuevas situaciones y evolucionan mecanismos de detoxificación (Robinson, 1997 citado por Altieri, 1998),

    24- Como los cultivos trangénicos son plantas patentadas, esto significa que los campesinos o agricultores pueden perder los derechos sobre su propio germoplasma regional y no se les permitirá reproducir, intercambiar o almacenar semillas de su cosecha. Por tanto es difícil concebir como se introducirá este tipo de tecnología en los países en vías de desarrollo de modo que favorezca a los agricultores pobres.

    25- No es posible predecir que va a pasar con un gen una vez que entra en un nuevo huésped. Cualquier predicción puede resultar frustrada debido al dinamismo de las poblaciones naturales. Cuando un gen entra a un ambiente diferente es capaz de generar procesos impredecibles, pues el mismo gen puede tener diferentes comportamientos en diferentes ambientes celulares. Por ejemplo, hace tres años se reportó que el mismo gen que produce cierto tipo de tumor en las plantas de tabaco por acción bacteriana, es el responsable de producir los nódulos que fijan nitrógeno en las plantas de alfalfa y produce los nódulos de la tuberculosis humana (Bravo, E., 1996).

    26- En la medida en que más universidades e institutos públicos de investigación se asocien con las corporaciones, aparecen cuestiones éticas más serias sobre quien es dueño de los resultados de la investigación y que investigaciones se hacen. Las tendencias a guardar el secreto de los investigadores universitarios involucrados en tales asociaciones trae a colación preguntas sobre ética personal y sobre conflictos de intereses. En muchas universidades, la habilidad de un profesor para atraer la inversión privada es a menudo más importante que las calificaciones académicas, eliminando los incentivos para que los científicos sean responsables ante la sociedad. Las áreas como el control biológico y la agroecología, que no atraen el apoyo corporativo, están siendo dejadas de lado y esto no favorece al interés público (Kleinman y Koppenburbg, 1988 citados por Altieri, 1998).

    27- Los consumidores, agricultores, familiares y ambientalistas de Brasil ganaron una batalla, cuando la jueza federal Raquel Fernández Perrini dictó una medida cautelar que prohíbe el cultivo de la soya RR (Roundup Ready) de Monsanto, en Brasil. La medida fue solicitada por el Instituto Brasileño de Defensa del Consumidor, recogiendo las preocupaciones de muchos grupos y organizaciones. La jueza afirma en la sentencia que "los alimentos genéticamente modificados son potencialmente ofensivos a la salud del consumidor, razón por la cual exigen una reglamentación específica y un estudio previo de impacto ambiental". Sin embargo, y sin haberse cumplido ninguna de estas condiciones, pocos días después, la CNTBio (Comisión de Bioseguridad de Brasil) decidió aprobar la liberación de soya transgénica, que tendría efectos una vez transcurridos el tiempo que dispone la medida cautelar.

    Con esta actitud altamente irresponsable, la CNTBio confirma las acusaciones de que viene siendo objeto por parte de asociaciones de pequeños agricultores que en meses pasados denunciaron que dicha comisión, "Viene actuando en forma aislada, sin ningún proceso de consulta ni esclarecimiento a la población, asumiendo para sí, en forma arrogante e irresponsablemente el derecho a decidir sobre lo que los brasileños comerán y cultivarán en el futuro próximo". Confirmando esta arrogancia, dicha comisión se opuso al etiquetado que advierta al consumidor que se trata de soya transgénica "aunque acatarán lo que decida la justicia en ese tema". Cabe preguntarse muchas cosas sobre los dudosos y parciales criterios de esta comisión. Una sola de ellas es: si están tan seguros de que el producto es inocuo, porque se oponen a su etiquetado y no dejan elegir al consumidor?.

    Se espera que en El Salvador C. A., no ocurra tal situación. Por tanto es muy sano y deseable que se muestre el documento: "Normas para el establecimiento de los requisitos fitosanitarios para la producción, movilización, importación y desarrollo de pruebas de campo de organismos manipulados mediante la biotecnología moderna". Dicho documento es necesario reestructurarlo desde el título hasta el contenido; no se trata de ser muy estrictos, más bien se desea proteger la salud humana y el medio ambiente.

    Un enfoque preventivo a la etiquetación de alimentos genéticamente diseñados fue elaborado por el Ph.D John Fagan, preparado también para el encuentro del 15 de mayo en Ottawa, Canadá.

    28- Por otro lado, se tiene conocimiento de que varias especies de Lepidoptera han desarrollado resistencia a la toxina de Bt en pruebas de campo y de laboratorio, sugiriendo que los mayores problemas de resistencia se desarrollan en cultivos transgénicos donde la expresión continua de la toxina crea una fuerte presión de selección (Taashnik, 1994). Dado que se ha aislado una diversidad de genes de la toxina Bt, los biotecnologos argumentan que si se desarrolla resistencia pueden usarse formas que es probable que los insectos desarrollen resistencia múltiple o resistencia cruzada, por tanto, tal estrategia también esta condenada al fracaso (Alstad y Andow, 1995).

    29- Basándose en experiencias pasadas con plaguicidas, otros han propuesto planes de manejo de la resistencia con cultivos transgénicos, tales como el uso de mezclas de semilla y refugios (Tabashnik, 1994). Además de requerir la difícil tarea de una coordinación regional entre agricultores, los refugios han presentado un éxito pobre con los plaguicidas químicos, debido al hecho que las poblaciones de insectos no están restringidas a un agroecosistema cerrado, y los insectos que entran están expuestos a cada vez más bajas dosis de la toxina en la medida que el plaguicida se degrada (Leibee y Capinea, 1995).

    30- Las toxinas de Bt pueden incorporarse al suelo a través del material vegetal que se descompone, pudiendo persistir durante 2-3 meses, resistiéndose a la degradación ligándose a las partículas de arcilla mientras mantienen la actividad de la toxina (Palm y otros, 1996). Tales toxinas de Bt que terminan en el suelo y el agua proveniente de los desechos de cultivos transgénicos puede tener impactos negativos en los organismos benéficos del suelo y en los invertebrados acuáticos, así como en el proceso de reciclaje de nutrientes (James, 1997). Todos estos aspectos merecen una investigación más seria.

    31- Efectos Río Abajo. Un efecto medioambiental mayor, como resultado del uso masivo de la toxina Bt en algodón u otro cultivo ocupando una inmensa superficie del paisaje agrícola, es que agricultores vecinos con cultivos diferentes al algodón, pero que comparten complejos similares de plagas, puede terminar con poblaciones de insectos resistentes colonizando sus campos. Es posible que plagas de Lepidoptera que desarrollan resistencia al Bt en algodón, se muevan a los campos adyacentes donde los agricultores usan Bt como un insecticida microbiano, dejando así a los agricultores indefensos contra tales plagas, en la medida que ellos pierden su herramienta de control biológico (Gould, 1994). ¿Quien sería responsable por tales pérdidas?.

    32- Impactos de los cultivos resistentes a enfermedades. Algunos científicos han intentado diseñar plantas resistentes a infecciones patogénicas incorporando genes para productos virales dentro del genoma de las plantas. Aunque el uso de genes para la resistencia a virus en cultivos tiene beneficios potenciales, hay algunos riesgos. La recombinación entre el ARN del virus y un ARN viral dentro del cultivo trangénico podría producir un nuevo patógeno que lleve a problemas de enfermedad más severos. Algunos investigadores han mostrado que recombinaciones ocurren en plantas transgénicas y que bajo ciertas condiciones se pueden producir una nueva raza viral con un rango alterado de huéspedes (Steinbrecher, 1996).

    33- Dada la velocidad con que los productos se mueven del laboratorio a la producción del campo, están los cultivos transgénicos respondiendo a las expectativas de la industria de la biotecnologia?. Según evidencia presentada por la Unión of Concerned Scientists, hay ya signos de que el uso a escala comercial de algunos cultivos transgénicos presenta riesgos ecológicos serios y no responde a las promesas de la industria.

    34- Muchas personas han argumentado por la creación de una regulación apropiada para mediar la evaluación y liberación de cultivos transgénicos para contrarrestar riesgos medioambientales y demandan una mayor evaluación y entendimiento de los temas ecológicos asociados con la ingeniería genética. Esto es crucial en la medida que los resultados que emergen acerca del comportamiento medioambiental de los cultivos transgénicos liberados sugieren que en el desarrollo de los "cultivos resistentes", no sólo deben evaluarse los efectos directos en el insecto o la maleza, sino también los efectos indirectos en la planta (ejemplo, crecimiento, contenido de nutrientes, cambios metabólicos, efectos en la salud humada y animal, efecto sobre la microflora benéfica del suelo, residuos dañinos en los suelos), y en otros organismos presentes en el ecosistema.

    35- Un equipo del Swiss Federal Research Station for Agroecology and Agriculture, detectó que en determinadas especies de insectos benéficos de las plagas, como crisopas (Chrysoperla carnea), la mortalidad aumentaba notablemente y su desarrollo se retrasaba cuando se alimentaban del gusano barrenador del maíz criados en plantas Bt (Hilbeck et al, 1998). Este efecto no había sido puesto de manifestó en los experimentos realizados por Novartis, al parecer por haberse realizado con larvas de crisopa alimentadas con huevos de insecto espolvoreados con Bt, sin tener en cuenta que dichas larvas no ingieren los huevos sino que succionan su contenido, no siendo por tanto afectadas por la toxina (Koechlin, 1999). Las conclusiones de este trabajo tienen importantes implicaciones tanto ecológicas como económicas, ya que una reducción de las poblaciones de enemigos naturales del barrenador resultaría en mayores problemas de control de plagas, y en desequilibrios ecológicos difíciles de prever.

    36- Investigadores de la Universidad de Cornell han descubierto recientemente que el polen del maíz Bt afecta a las larvas de la mariposa monarca (Danaus plexippus), especie protegida amenazada, ocasionando una notable mortalidad en las larvas alimentadas en el laboratorio con hojas espolvoreadas con polen procedente de maíz Bt (Losey et al, 1999). Si bien una de las conclusiones de este trabajo es la necesidad de ser complementados con estudios de investigación más amplios, los resultados son enormemente preocupantes, y sugieren una temeraria ausencia de información sobre el impacto ambiental real del cultivo transgénico Bt.

    37- Una de las razones por las cuales las variedades Bt pueden afectar a especies beneficiosas, y no sólo a los insectos plaga que se pretende combatir, es que en las variedades transgénicas el gen de la toxina Bt es un gen truncado, que corresponde a un fragmento del gen que codifica la proteína insecticida en el Bacilus thuringiensis. Esto se debe a que la toxina Bt natural es un compuesto proteínico muy largo, que no sería soluble en las vegetales (Tappesser, 1997, pag. 4). Como consecuencia, la proteína Bt presente en las variedades transgénicas, relativamente pequeña, puede ser asimilada directamente a través de la membrana estomacal de los insectos de algunas especies, para ser activada, comportándose por tanto de forma mucho más selectiva. Esta diferencia entre las repercusiones en el medio ambiente de una toxina inactiva y la presencia de una toxina activa de forma permanente no parecen haber sido tenidas en cuenta en la evaluación de riesgos.

    38- En el caso de compañías multinacionales como Unilever y Nestlé anunciaron públicamente el no incluir productos transgénicos en los alimentos que elaboran.

    Según evidencias presentadas por la Unión of Concerned Scientists, ya hay signos de que el uso a escala comercial de algunos cultivos transgénicos presentan riesgos ecológicos y no responden a las promesas de la industria (ver cuadro).

    Cuadro: Comportamiento en el campo de algunos cultivos transgénicos recientemente liberados*.

    Cultivo Transgénico Liberado

    Comportamiento

    Referencia

    1. Algodón Bt Transgénico

    Aspersiones adicionales de insecticidas fueron necesarias dado que el algodón Bt falló en el control de bellotero en 20,000 acres en el este de Texas.

    The Gene Exchange, 1996; Kaiser, 1996.

    2. Algodón insertado con el gene Readgo resistente al Round-up

    Bellotas deformes y cayéndose en 4 - 5 mil acres en el delta del Mississipi.

    Lappe y Bayley, 1997 ; Myerson, 1997.

    3. Maíz Bt

    Reducción del 1.7% en el rendimiento y niveles de Cu foliar en una prueba en Beltsville.

    Hormick, 1997.

    4. Variedades de tomate FLAVR - SAVR

    Presenta bajos rendimientos y exhibe comportamientos no aceptable en la resistencia a enfermedades.

    Biotech Reporter, 1996

    5. Papas Bt

    Afidos secuestran la toxina de Bt, lo cual afecta negativamente a los depredadores benéficos (Coccinellidae).

    Birch y otro, 1997

    6. Calabazas resistentes a virus

    Resistencia vertical a dos virus y no a otros transmitidos por áfidos.

    Rissler, J. (comunicación personal)

    7. Raps resistente a herbicidas

    Polen escapa y fertiliza botánicamente plantas relativas en un radio de 2.5 km. En Escocia.

    Scottish Crop Research Institute, 1996)

    8. Canola (Colza) resistente al Round-up

    Sacada del mercado por la contaminación con un gene no aprobado por los organismos reguladores.

    Rance, 1997

    9. Varios cultivos tolerantes a herbicidas.

    Desarrollo de resistencia del ryegrass anual al Round-up.

    Gill, 1995

    *Ph.D. Miguel Añltieri. Riesgos ambientales de los cultivos transgénicos: una evaluación agroecológica. Universidad de California, Berkeley.

    39- Por otra parte, la simplificación de la acción insecticida de la toxina Bt producida por las plantas transgénicas, en comparación con los mecanismos insecticidas mucho más completos del Bacillus thuringlesis (Tappeser, 1997, pgs. 2-4), puede favorecer una rápida respuesta evolutiva de los insectos y de la aparición de poblaciones resistentes.

    40- Es preciso apuntar, además, que la especie que se pretende controlar con las variedades transgénicas Bt, el barrenador del maíz, es una especie que no existe como plaga en El Salvador C.A., por lo que estudios de plantas Bt para controlar esta plaga es difícilmente justificable en nuestro país.

    41- La producción de toxinas en los cultivos Bt es continua (a lo largo de todo el ciclo), y el insecticida se produce en todas las partes de la planta. Diversos trabajos de investigación habían alertado en los últimos años de la posible acumulación de toxinas insecticidas en el entorno, y en particular en los suelos cultivados con plantas Bt, debido a la incorporación al suelo de materia vegetal de dichos cultivos, y a su persistencia en determinados suelos. A diferencia de los preparados insecticidas orgánicos basados en el Bacillus thuringiensis, que se descomponen con los rayos ultravioletas al ser expuestos a la luz, la toxina procedente en estado activo adherida a partículas del suelo durante periodos relativamente prolongados, y resultando letal para las larvas de algunos insectos (Tapp & G. Stotzky, 1995). Esta facilidad de las proteínas insecticidas para adherirse a partículas del suelo, y su persistencia en estado activo durante periodos prolongados, constatada recientemente en trabajos de investigación (Crecchio & Stotzky, 1988), podría constituir un grave riesgo para la comunidad biótica presente en el suelo, pudiendo dar lugar a la evolución de resistencias y a desequilibrios ecológicos importantes que afectarían la fertilidad de los suelos.

    42- En las plantas Bt, la posibilidad de evolución de resistencia en los insectos plaga se considera muy probable (ineludible, según algunos autores), dado que esta característica esta siendo introducida en gran número de cultivos (algodón Bt, maíz Bt, papa Bt, etc.), y teniendo en cuenta además que han aparecido poblaciones de insectos en el medio natural con índices de resistencia mucho mayores de los previstos (Gould et al, 1997). Por otra parte, el descubrimiento de resistencias cruzadas al Bt, por las que un gen confiere a los individuos resistentes protección contra cuatro toxinas Bt diferentes (Tabashnik et al., 1997), ha obligado a descartar la posibilidad de utilizar diferentes versiones de la toxina Bt en las plantas transgénicas como estrategia para retrasar la inutilización de este insecticida.

    43- El maíz Bt de Novartis es portador de un gen de resistencia a la ampicilina (gen blatem-1) utilizado como marcador para seleccionar las células transformadas en el laboratorio en el proceso de manipulación genética. La diseminación del gen blatem-1, a bacterias patógenas puede tener consecuencias particularmente preocupantes, dado que este gen confiere resistencia a una de las clases de antibióticos más utilizados en terapia humana (penicilina G, ampicilina, amoxycicilina, etc), y que una mutación puntual de este gen (el cambio de un par de bases, un evento genético muy común) ampliaría su campo de actividad, ampliando así la lista de antibióticos inactivados por la enzima codificada por el gen (incluyendo algunos de los antibióticos más recientes, del grupo de los cefalosporines) (Courvalin, 1998; informe Oekoinstitut, 1998).

    44- Además, según un informe del director de la Unidad de Agentes Antibacterianos del prestigioso Instituto Pasteur publicado recientemente por La Recherche, la diseminación de resistencia a los anteriores antibióticos en las bacterias patógenas para el hombre varía enormemente de una especie (y de una región geográfica) a otra. El informe subraya además el hecho preocupante de que algunas de las especies bacterianas que tendrían mayores posibilidades de incorporar el gen de resistencia son responsables de algunas de las infecciones que afectan muy frecuentemente al sector de la población (creciente) que padece inmunodeficiencias (pacientes afectados por el SIDA, por leucemia, o sometidos a tratamientos de quimioterapia contra el cáncer).

    Dado que la presencia de este tipo de marcadores es innecesaria y tiene gravísimos riesgos para la salud, diversas instituciones médicas y gubernamentales (British Medical Association, 1999; Comité Económico y Social de la UE, 1999, Parlamento Europeo, 2000) han solicitado la prohibición de este tipo de plantas transgénicas, argumentado que el riesgo para la salud humana con desarrollo de resistencia a los antibióticos en los microorganismos es una de las mayores amenazas a las que la humanidad deberá enfrentarse en el siglo XXI.

    Recomendaciones.

    La complejidad de la situación antes expuesta nos plantea la necesidad de diferentes estrategias y niveles de intervención en tal sentido se mencionan las siguientes recomendaciones:

    1- Se hace necesario una estrategia de investigación a nivel local, nacional y regional. Se requiere promover e impulsar:

  • Investigaciones bioecológicas, tendientes a identificar y valorar las especies nativas benéficas a nivel de micro y macroorganismos, para asumir el CONTROL BIOLOGICO;

  • Recuperación y fortalecimiento de identidad cultural;

  • Prácticas para la recuperación y conservación de ecosistemas naturales (se hace necesario crear más áreas de reserva natural);

  • Recuperación y conservación de la biodiversidad, a través de una adecuada Estrategia Nacional de Biodiversidad.

  • 2- El Gobierno de la República de El Salvador, C.A., a través del Centro Nacional de Tecnología Agropecuaria y Forestal (CENTA), debe impulsar la creación de CENTROS NACIONALES DE CONTROL BIOLOGICO para la Reproducción y Liberación de Organismos Benéficos. Parte del presupuesto destinado a la agricultura tiene que ser orientado a dicha área, la cual siempre es descuidada por los responsables de tomar las decisiones.

    3- Se deben cumplir los convenios firmados, como por ejemplo: el Gobierno de la República de El Salvador, C.A., ratificó en la CUMBRE DE LA TIERRA DE RIO DE JANEIRO EN 1992, el convenio sobre Diversidad Biológica, en donde el artículo 8, literal "g", expresa . . . . se establecerá o mantendrá medios para regular, administrar o controlar los riesgos derivados de la utilización y la liberación de organismos vivos modificados como resultado de la biotecnología, que es probable que tengan repercusiones ambientales adversas que puedan afectar a la conservación y a la utilización sostenible de la diversidad biológica, teniendo también en cuenta los riesgos para la salud humana.

    4- Las universidades que cuentan con carreras de biología y agronomía, tienen que impulsar el desarrollo del CONTROL BIOLOGICO Y LA AGROECOLOGIA. También se hace necesario impulsar el desarrollo de estudios de postgrado con alta calidad académica-científica que ayuden a solucionar los problemas existentes y los que se esperan a corto, medio y largo plazo.

    5- Estrategia Nacional en Biotecnología. Con la participación activa de sectores académicos, estatales, comunidades locales, ONGs, etc., es necesario definir las necesidades reales de nuestro país y los requerimientos para poner en práctica la estrategia Nacional en Biotecnología.

    6- Debido a los peligros que representa el uso de cultivos transgénicos, es recomendable que en nuestro país se establezcan legislaciones específicas, en el espíritu del Protocolo de Bioseguridad, para que los experimentos, el uso y la liberación de organismos transgénicos se hagan de acuerdo a las normas de alta seguridad.

    7- Es necesaria una estrategia de precaución que debería considerar una normativa sobre la no liberación de organismos transgénicos, hasta que se tengan las legislaciones escritas y consultadas con los diferentes sectores de la sociedad (dar a conocer los escritos a la opinión pública) para su posterior aprobación en El Salvador. Es recomendable detener el uso de cultivos transgénicos y dar el apoyo económico e infraestructura adecuada a los Centros Nacionales de Investigación y a la Universidad de El Salvador para evaluar los efectos peligrosos de dichas plantas. Tanto el Gobierno como las mismas transnacionales que promueven sus productos transgénicos, deben aportar la ayuda adecuada para realizar las investigaciones necesarias. Otro factor muy importante es que las investigaciones encaminadas hacia la evaluación de los efectos peligrosos de los organismos transgénicos, tienen que ser desarrolladas por técnicos idóneos y sin compromisos políticos sesgados, para obtener resultados confiables con buena base científica.

    8- Antes de realizar ensayos de campo, se tienen que efectuar diferentes estudios a nivel de laboratorio, invernadero, cámara de crecimiento o cualquier otra estructura o recinto cerrado con las condiciones de bioseguridad bien establecidos. Dichos estudios tienen que ir enfocados a evaluar los efectos peligrosos (al medio ambiente, la salud humana, la salud animal, la salud del suelo, etc.) de tales organismos manipulados genéticamente; cuando los resultados sean favorables, se justifica realizar la siguiente etapa consistente en la evaluación a nivel de campo (a nivel experimental), tomando en cuenta las medidas correspondientes y enfocando los estudios en busca de la protección del medio ambiente y la salud humana entre otros.

    9- Es recomendable una garantía de transparencia informativa y una mejor participación pública en la toma de decisiones relacionadas con la ingeniería genética.

    10- Es recomendable el etiquetado de todos los productos de la ingeniería genética.

    11- La exigencia de responsabilidad civil a la industria o institución responsable de perjuicios ambientales o socioeconómicos derivados de la experimentación con ingeniería genética o sus aplicaciones comerciales.

    12- Esfuerzos y capacidades institucionales nacionales para evaluar, supervisar, reglamentar y/o controlar la ingeniería genética.

    13- La adopción del principio de precaución en la política nacional relacionada con las actividades de ingeniería genética.

    14- Mantenimiento obligatorio de registros nacionales de las actividades de ingeniería genética que faciliten el control de posibles resultados adversos.

    15- La dotación de mayores recursos públicos a líneas de investigación en las diversas ciencias de la vida, evitando su concentración en el campo de la ingeniería genética, con el objetivo de evaluar mejor sus repercusiones ecológicas, y estudiar posibles soluciones alternativas.

    16- Es recomendable que en El Salvador no exista un descuido de las normas y directrices de seguridad relacionados con la ingeniería genética. Por tanto, es muy importante que se tomen en cuenta las diferentes observaciones y/o sugerencias que se han planteado en relación al Anteproyecto de Ley de Semillas de El salvador, C.A.

    17- El tremendo crecimiento de la biotecnología no ha sido correspondido por un desarrollo paralelo de la necesaria infraestructura para educación (Universidades Nacionales) e investigación en cuestiones de bioseguridad, para evaluación de los impactos ambientales de la ingeniería genética, y para reglamentación y medidas de seguridad. En El Salvador, se tiene que trabajar fuertemente en dichos aspectos para que el Gobierno no este divorciado de la Universidad de El Salvador.

    18- Hay base fundada para sospechar que quienes propugnan la ingeniería genética están siguiendo una política de "ignorancia estratégica", caracterizada por el descuido en nuestros países de normas y consideraciones sobre seguridad, el menosprecio de contribuciones y evaluaciones científicas, y la ocultación de información sobre efectos adversos. En tal sentido es importante el intercambio de información relacionada con dicha temática.

    19- El gobierno y las instituciones intergubernamentales competentes deberían considerar seriamente y con la mayor urgencia la necesidad de una moratoria sobre la liberación comercial de organismos manipulados mediante la ingeniería genética en el medio, así como los mecanismos necesario para ello, con el fin de crear el espacio necesario para un discurso correcto sobre las evaluaciones de impacto ambiental, social y sobre salud, y sobre procedimientos de prevención de riesgos, realización de pruebas y supervisión.

    20- Es necesario documentarnos para hacer posible un examen científico de cuestiones sobre seguridad, así como la incorporación de aportaciones científicas a las políticas institucionales de nuestro país. Debería además procurar un plazo suficiente para la realización de verdaderas pruebas y estudios de los efectos de organismos manipulados mediante la ingeniería genética a corto, medio y largo plazo. Lo anterior debería conducir a un conocimiento y evaluación más comprensiva de los impactos de la ingeniería genética, de forma que se creen las condiciones precisas para la introducción de políticas nacionales y de un enfoque racional y a largo plazo en cuestiones sociales, económicos, éticos y de seguridad.

    21- El principio de precaución ("Cuando hubiere riesgos de daño grave o irreversible, la falta de certeza científica absoluta no debería emplearse como argumento para justificar la dilatación de medidas que impidan la degradación ambiental y daños a la salud humana"), incorporando en 1992 a la DECLARACIÓN DE RIO de los Jefes de Estado del Mundo, debería regir siempre las políticas y actividades relacionadas con la ingeniería genética.

    22- Deberían asignarse recursos más amplios y adecuados para la realización de evaluaciones científicas y objetivas de los efectos sociales, económicos y sobre la seguridad y la salud humana, que pueden causar los productos de la ingeniería genética.

    23- Realizar evaluaciones que demuestren que los organismos benéficos (enemigos naturales útiles en control biológico) no serán dañados con los productos de la ingeniería genética.

    24- Las instituciones oficiales, industrias e investigadores de El Salvador C. A., deberían hacer un esfuerzo urgente por adoptar una "cultura de la seguridad", en la cual seguridad y salud humana constituyen la máxima prioridad. En nuestro país se tiene que desarrollar un amplio marco general para la evaluación de impacto, políticas de seguridad, medidas de regulación, acompañadas de un debate público bien informado.

    25- El Gobierno de la República de El Salvador, C. A., debería instituir urgentemente registros nacionales para los proyectos de investigación y otras actividades que conlleven el uso de ingeniería genética (inclusive liberaciones actuales y anteriores), y establecer sistemas de supervisión como parte integral de las medidas de seguridad normales.

    26- Debería llevarse a cabo un inventario de los permisos (actuales y anteriores) de los diferentes materiales productos de la ingeniería genética, cuya información debiera estar a disposición de cualquier institución nacional o extranjera.

    27- Tiene que existir una verdadera comisión nacional de bioseguridad que este representada por los diferentes sectores de la sociedad, sin excluir instituciones y personas idóneas. Si es posible contratar especialistas en ciencias genéticas (aprovechar el recurso existente en el país), con el objetivo de que dicha comisión sea más consistente y tenga buenos argumentos para la toma de decisiones. Se espera acciones concretas que creen confianza y una gran voluntad de hacer bien las cosas y no argumentar que no existen fondos económicos en el presupuesto nacional.

    28- Las tendencias desatadas por la biotecnología deben ser equilibradas por políticas publicas y opciones de los consumidores en apoyo de la sostenibilidad. Medidas que ayuden a promover la sostenibilidad y el uso múltiple de la biodiversidad al nivel de la comunidad, con énfasis en tecnologías que permitan la autosuficiencia y el control local de los recursos económicos como medios para promover una distribución de los beneficios.

    29- Las tendencias desatadas por la biotecnología deben ser equilibradas por políticas publicas y opciones de los consumidores en apoyo a la sostenibilidad. Medidas que deben promover la sostenibilidad y el uso múltiple de la biodiversidad al nivel de las comunidades, con énfasis en tecnologías que promuevan la autosuficiencia y el control local de los recursos económicos como medios para promover una distribución mas justa de los beneficios.

    ¿Qué es la clonación?

    Hay que diferenciar el uso de la palabra clonación en distintos contextos de la biología:

    Si nos referimos al ámbito de la Ingeniería Genética, clonar es aislar y multiplicar en tubo de ensayo un determinado gen o, en general, un trozo de ADN. Sin embargo, Dolly no es producto de Ingeniería Genética.

    En el contexto a que nos referimos, clonar significa obtener uno o varios individuos a partir de una célula somática o de un núcleo de otro individuo, de modo que los individuos clonados son idénticos o casi idénticos al original.

    En los animales superiores, la única forma de reproducción es la sexual, por la que dos células germinales o gametos (óvulo y espermatozoide) se unen, formando un zigoto (o huevo), que se desarrollará hasta dar el individuo adulto. La reproducción sexual fue un invento evolutivo (del que quedaron excluidas las bacterias y muchos organismos unicelulares), que garantiza que en cada generación de una especie van a aparecer nuevas combinaciones de genes en la descendencia, que posteriormente será sometida a la dura prueba de la selección y otros mecanismos evolutivos. Las células de un animal proceden en última instancia de la división repetida y diferenciación del zigoto.

    Las células somáticas, que constituyen los tejidos del animal adulto, han recorrido un largo camino "sin retorno", de modo que, a diferencia de las células de las primeras fases del embrión, han perdido la capacidad de generar nuevos individuos y cada tipo se ha especializado en una función distinta (a pesar de que, salvo excepciones, contienen el mismo material genético).

    El primer experimento de clonación en vertebrados fue el de Briggs y King (1952), en ranas. En los años 70, Gurdon logró colecciones de sapos de espuelas (Xenopus laevis) idénticos a base de insertar núcleos de células de fases larvarias tempranas en ovocitos (óvulos) a los que se había despojado de sus correspondientes núcleos. Pero el experimento fracasa si se usan como donadoras células de ranas adultas.

    Desde hace unos años se vienen obteniendo mamíferos clónicos, pero sólo a partir de células embrionarias muy tempranas, debido a que aún no han entrado en diferenciación (y por lo tanto poseen la propiedad de pluripotencia). No es extraño pues el revuelo científico cuando el equipo de Ian Wilmut, del Instituto Roslin de Edimburgo comunicó que habían logrado una oveja por clonación a partir de una célula diferenciada de un adulto. Esencialmente el método (que aún presenta una alta tasa de fracasos) consiste en obtener un óvulo de oveja, eliminarle su núcleo, sustituirlo por un núcleo de célula de oveja adulta (en este caso, de las mamas), e implantarlo en una tercera oveja que sirve como “madre de alquiler” para llevar el embarazo. Así pues, Dolly carece de padre y es el producto de tres "madres": la donadora del óvulo contribuye con el citoplasma (que contiene, además mitocondrias que llevan un poco de material genético), la donadora del núcleo (que es la que aporta la inmensa mayoría del ADN), y la que parió, que genéticamente no aporta nada.

    Científicamente se trata de un logro muy interesante, ya que demuestra que, al menos bajo determinadas circunstancias es posible "reprogramar" el material genético nuclear de una célula diferenciada (algo así como volver a poner a cero su reloj, de modo que se comporta como el de un zigoto). De este modo, este núcleo comienza a "dialogar" adecuadamente con el citoplasma del óvulo y desencadena todo el complejo proceso del desarrollo intrauterino.

    Fecundación y desarrollo embrionario

    Desarrollo de las células germinales femeninas: es un proceso muy prolongado, que arranca de la fase fetal, y que concluye en la adulta.

  • Células primordiales germinales: se originan en la cresta germinal. Al recibir ciertas señales de las células del plexo dorsal de la cresta germinal, las células germinales primordiales entran en meiois, y pasan de diploides a haploides. Se detienen en diplotene hasta la fase adulta (hasta 50 años). En el ovario fetal los ovocitos primarios están rodeados y nutridos por una capa de células foliculares. Antes de la pubertad hay muerte programada de ovocitos, y desde la pubertad, algunos de estos ovocitos seguirán su desarrollo.

  • Fase de crecimiento: No hay cambios en el ciclo celular, pero existe una gran actividad transcripcional, con aumento de 200 veces del tamaño del ovocito. Parte del ARN queda “silente”, acomplejado con proteínas. Estos dos tipos de macromoléculas serán las esenciales para asegurar las primeras fases del zigoto y del embrión. Formación de la zona pelúcida (ZP), que separa al ovocito de las células foliculares.

  • Fase de diferenciación: Durante las 48 horas previas a la fecundación las gonadotrofinas actúan sobre el folículo, cuyas células somáticas responden produciendo señales que reprograman al ovocito. Se usa el ARN almacenado en la fase previa

  • Las señales intrafoliculares iniciales para la maduración del ovocito provocan el paso desde G2 hasta M de la meioisis.

    Reaparece el ARNm enmascarado, y se traduce. Movimientos de orgánulos citoplásmicos.

    En la fecundación se unen los gametos femeninos (óvulo) y masculino (espermatozoide). Al entrar el espermatozoide, se activa el óvulo, que termina su diferenciación: final de la meiosis

    Zigoto (célula huevo): finaliza la meiosis del óvulo, con eliminación del segundo cuerpo polar. Los procesos que ocurren durante las primeras horas son:

    Se duplica el ADN de los genomas haploides de cada gameto

    Singamia: aproximación de los pronúcleos de cada gameto, pero sin fusión nuclear.

    Primera división mitótica: los cromosomas quedan engarzados en el huso mitótico, y las cromátidas hermanas se separan.

    Aspectos relevantes para el trasplante de núcleos:

    El trasplante de núcleos somáticos a óvulos enucleados tiene la intención de lograr lo que hacen de modo natural los dos pronúcleos del ovocito recién fertilizado.

    Cuando entra el espermatozoide, éste se encuentra en fase Go, mientras que el ovocito está en la segunda metafase meiótica (MII). Luego se descondensa el núcleo del espermatozoide y se sincronizan ambos ciclos celulares, ingresando al mismo tiempo en la fase S (síntesis de ADN).

    Fase de diferenciación: Durante las 48 horas previas a la fecundación las gonadotrofinas actúan sobre el folículo, cuyas células somáticas responden produciendo señales que reprograman al ovocito. Se usa el ARN almacenado en la fase previa

    En la activación del ovocito por el espermatozoide intervienen aumentos cíclicos de Ca++ intracelular.

    Ello provoca el descenso de actividad de la MPF quinasa (por degradación de la ciclina B y fosforilación de cdc2).

    Ello inhibe las moléculas bloqueadoras de la metafase II, lo que hace que el óvulo termine la mitosis.

    Se desenmascaran más ARNm, que se traducen.

    Al introducir un núcleo somático, tenemos que lograr sincronizarlo con la fase del ovocito y “remedar” los cambios fisiológicos arriba citados. Algunos de los protocolos artificiales estimulan la entrada de Ca al ovocito.

    La electroestimulación provoca un aumento de Ca++ único, pero no las oleadas de Ca++.

    Se mejora con pulsos de corriente o por ionomicina.

    Pero aún necesitamos mejorar para simular las condiciones naturales.

    Requisitos de ciclo celular:

    Sincronización núcleo-citoplasma.

    Periodo de reprogramación nuclear, para su adaptación al entorno citoplásmico.

    Si se usan núcleos de células diferenciadas, deben “desdiferenciarse” para lograr la totipotencia. Ello solo puede conseguirse con el citoplasma meiótico en fase M. El grupo de Wilmut (1996) concluyó que el éxito aumenta con núcleos somáticos en fase G0 y citoplasmas en fase MII.

    En el reciente trabajo sobre la clonación de ratones, las condiciones mejores fueron:

    La activación se realiza dejando un cierto tiempo (6 horas) tras la inyección del núcleo donante en G0.

    La activación se induce con estroncio y citocatalasina B (con supresión de citoquinesis). Aunque esto parece paradójico en relación con otros informes, la exposición prolongada de los núcleos entrantes a un ambiente rico en MPF causa una duradera condensación de cromosomas (en ausencia de síntesis de ADN), y puede facilitar los cambios nucleares que son esenciales para el desarrollo e implantación del blastocisto.

    Puede que influya también el uso de una unidad de micropipeta de piezo-impacto, que permite que las manipulaciones del oocito y del embrión sean rápidas y eficaces, reduciendo así el trauma de otros métodos (electrofusión, Virus Sendai o PEG).

    Pero incluso el “dogma” de la necesidad de usar células quiescentes como donantes parece que se tambalea: la reciente clonación de ratones usando células madre en fase G1 o en post-fase S (fases G2 y M) así lo indica. Recientemente, el grupo de PPL-Roslin, ha logrado cinco cerdos clónicos mediante un nuevo procedimiento de doble transferencia nuclear, a partir de células no quiescentes (I.A. Polejaeva et al. [2000]: “Cloned pigs produced by nuclear transfer from adult somatic cells”, Nature 407: 86-90).

    Por ahora, parece que no todas las células somáticas son susceptibles de poder usarse como donantes de núcleos para la clonación. Se desconoce si se trata de un problema biológico o meramente técnico. Si es biológico, habrá que investigar qué es lo que hace que algunas células sean reprogramables y otras no, y cuál es la naturaleza de la reprogramación (obviamente debe haber activación y represión de genes). ¿Tiene algo que ver en la tasa de fracasos algo relacionado con la impronta genética?

    Gemelos y mellizos

    Gemelos dizigóticos (no idénticos): se originan por la fecundación de dos o más óvulos por distintos espermatozoides. Tasa de 0.6-1-1%nacimientos. Gran heredabilidad e incidencia de factores ambientales (nutrición, edad, etc.)

    Gemelos monozigóticos (idénticos): por fisión de un embrión temprano. 0.3-0.4% de nacimimientos.

    Tipos de clonación

    Tipos de clonación según el método

  • Partición (fisión) de embriones tempranos: analogía con la gemelación natural. Los individuos son muy semejantes entre sí, pero diferentes a sus padres. Es preferible emplear la expresión gemelación artificial, y no debe considerarse como clonación en sentido estricto.

  • Paraclonación: transferencia de núcleos procedentes de blastómeros embrionarios o de células fetales en cultivo a óvulos no fecundados enucleados y a veces, a zigotos enucleados. El “progenitor” de los clones es el embrión o feto.

  • Clonación verdadera: transferencia de núcleos de células de individuos ya nacidos a óvulos o zigotos enucleados. Se originan individuos casi idénticos entre sí (salvo mutaciones somáticas) y muy parecidos al donante (del que se diferencian en mutaciones somáticas y en el genoma mitocondrial, que procede del óvulo receptor).

  • Gemelación artificial

    Partición de un embrión, o separación de blastómeros en embriones preimplantatorios (de 2-32 células). Cada mitad o trozo desgajado del embrión se introduce en una zona pelúcida de otro óvulo, o en una cubierta artificial (ZPA), y se implanta.

    Embriones se mojan en 1% de alginato y se transfieren a medio con Cl2Ca, que induce la polimerización.

    En ratones, tiene éxito con blastómeros separados en fase de 2 células. Pero los blastómeros de embriones de 4-8 células pueden suministrar células para la masa celular interna y para el trofectodermo si se incorporan junto con blastómeros de otros embriones.

    Se viene aplicando desde hace años en ganadería. Estudios de Willadsen (1979 y 1981) sobre ovejas: algunos blastómeros de embriones de 4-8 células pueden originar individuos completos.

    Recientemente se ha hecho en monos (macacos Rhesus)

    En humanos hubo un experimento polémico (Hall y Stillman, 1993) con un zigoto poliploide inviable (no se pretendía implantarlo). Más estudios del equipo de Paul Gindoff de la Universidad G. Washington con embriones anómalos: los embriones más tempranos son mejores para la separación de blastómeros. La ZP natural se disgrega con pronasa y se colocan los embriones en Ca para separar los blastómeros. Inclusión de blastómeros en ZPA de alginato. La capacidad de división de los blastómeros de fases de 2 células era de 3 divisiones, y disminuía con blastómeros más tardíos.

    El resultado son individuos prácticamente idénticos entre sí (salvo mutaciones somáticas), pero diferentes a sus padres. Serían equivalentes a gemelos monozigóticos.

    No se debe considerar como clonación en sentido estricto.

    Paraclonación: por transferencia de núcleos de células embrionarias o fetales

    Los núcleos pueden proceder de:

    Blastómeros de embrión preimplantatorio: las células de la masa celular interna como las del trofectodermo son totipotentes.

    Células embrionarias o fetales de un cultivo primario o de un cultivo celular.

    Estos núcleos se transfieren a un óvulo enucleado o a un zigoto al que se le hayan eliminado los pronúcleos. Este óvulo receptor aporta mitocondrias, y en el caso del zigoto, algo del espermatozoide.

    El resultado: individuos casi idénticos entre sí, pero diferentes de los progenitores del embrión que aportó el núcleo transferido. Se pierde una generación, ya que el embrión donante del núcleo se destruye. Los individuos nacidos así se parecerían (desde el punto de vista del genoma nuclear) al individuo que hubiera surgido del embrión destruido.

    A mitad de los 80 se venían produciendo paraclonaciones en diversos animales de granja: ovejas y vacas Willadsen logró terneros por transferencia de núcleos de embriones en fase de hasta 128 células. En 1996 el equipo de Wilmut y Campbell logró dos ovejas (Megan y Morag) por transferencia de núcleos de embriones. PPL siguió con experimentos de paraclonación con células embrionarias y fibroblastos fetales

    Se ha descrito igualmente la producción de monos Rhesus por transferencia de núcleos de blastómeros. En un caso se dividieron 107 embriones en 368 unidades, lográndose 4 embarazos, de uno de los cuales nació Tetra. Alguno de los intentos condujo a embarazos “ciegos”, consistentes en un saco placentario desprovisto de tejido fetal. En una postdata los autores anuncian que acaban de lograr 4 embarazos, cada uno con un feto viable, a partir de los últimos 7 embriones originados por separación de blastómeros. Dos de los fetos son gemelos idénticos por fisión de un embrión original. Nacieron vivos y se llaman Neti y Ditto.

    Se ha empleado en animales transgénicos clónicos. Polly (julio 1997), de PPL, es una oveja paraclónica (núcleo donante: fibroblastos fetales) transgénica productora de factor IX de coagulación humano. Intentos de cerdos modificados para xenotrasplantes.

    Un avance reciente significativo es la clonación de decenas de ratones empleando núcleos de células madre no quiescentes, realizado por un equipo de la Universidad de Hawai y la Universidad Rockefeller. Una de las mayores incidencias de este trabajo es que demuestra que se puede clonar con núcleos de células en cultivo bien caracterizadas, y no solamente con células frescas o cultivos primarios. Como las células madre de ratón se manejan bien desde el punto de vista genético, esto abre la vía a la fácil creación de ratones clónicos y transgénicos.

    Clonación (en sentido estricto): por transferencia de núcleos de células de individuos nacidos.

    El núcleo procede de individuo nacido. Se transfiere a óvulo o zigoto enucleados, y el embrión se implanta en útero. El resultado: individuos casi idénticos entre sí y casi idénticos a su progenitor (donante del núcleo).

    Se ha logrado en varias especies:

    Oveja (Dolly). Núcleo donante de célula sin identificar de ubre de oveja de 6 años de la raza Finn Dorset. Embrión implantado en hembra Scottish Blackface. Baja tasa de éxitos: 430 óvulos, de los que se obtuvieron 277 óvulos reconstituidos, que se cultivaron por separado durante 6 días. 29 blastocistos “normales” se transfirieron a hembras receptoras. El único éxito fue Dolly. Algunos fueron fetos o neonatos muertos, o con alteraciones del desarrollo.

    Ratones, con núcleos del cúmulo oóforo. (El primer ratón clónico nació el 3 de octubre de 1997, y fue llamado Cumulina; ya ha tenido progenie aparentemente normal, que a su vez se ha reproducido). El haber obtenido clones en esta especie de laboratorio, con ciclo de vida corto y de la que se tienen amplios conocimientos de su genética, abre perspectivas insospechadas para los estudios básicos sobre la clonación: mecanismos de la reprogramación celular, impronta (imprinting) genómica, activación del genoma del embrión, diferenciación celular, etc. Poco después, este mismo equipo japonés informó de la clonación de ratones a partir de células del rabo de ratones adultos.

    Ganado bovino: núcleos de células epiteliales del oviducto, del cúmulo oóforo, epiteliales, musculares.

    Ganado caprino.

    Recientemente se ha logrado en ganado porcino: el grupo de Roslin-PPL lo ha conseguido con un nuevo método de doble transferencia nuclear, con el nacimiento de cinco lechones, con dos subgrupos de tres y dos que eran clones entre sí y con respecto al correspondiente donante. Sus nombres: Millie, Christa, Alexis, Carrel y Dotcom. (I.A. Polejaeva et al. [2000]: “Cloned pigs produced by nuclear transfer from adult somatic cells”, Nature 407: 86-90).

    ¿Un protocolo universal para clonación reproductiva?

    El grupo de Wakayama, en el artículo reciente que informa sobre clonación de ratones a partir de núcleos de células madre, propone un posible esquema que permitiría la clonación ilimitada a partir de casi cualquier célula del organismo (al menos en esta especie):

  • Transferencia por microinyección de un núcleo de célula somática a un óvulo enucleado.

  • Se dejaría desarrollar el embrión in vitro hasta una fase previa a la de implantación.

  • A partir de las células de la masa interna del blastocisto se pueden establecer cultivos estables (inmortales) de células madre (ES). Todas esas células contendrían el mismo genoma nuclear que el individuo donante, genoma que quedaría de esta forma “inmortalizado”.

  • Las células madre pueden servir a su vez para:

  • Terapias celulares

  • Clonación reproductiva

  • Manipulación genética: se podrían generar ratones mutantes, incluso en homozigosis, en una sola generación, sin pasar por la generación intermedia de quimeras. Ello permitiría analizar las funciones complejas que dependen de varios genes.

  • Combinación de b) y c) para producir individuos clónicos transgénicos.

  • Fines (teóricamente posibles) de los distintos tipos de clonación 5.1 De la gemelación artificial

    En animales:

    Investigación básica

    Mejora de FIV

    Mejora de fertilidad de las especies empleadas.

    En humanos:

    En FIV, para mejorar resultados en mujeres con pobre estimulación ovárica

    Gemelos idénticos separados en el tiempo

    De la paraclonación

    En animales:

    Individuos idénticos para investigación

    Producción ganadera

    Junto con clonación, para biotecnología: tejidos “humanizados”, granjas farmacéuticas

    Fuentes de tejidos, para xenotrasplantes

    En humanos:

    ¿investigación básica y aplicada?

    ¿Terapia? Para enfermedades mitocondriales que producen ceguera o epilepsia: transferencia del núcleo del embrión hasta un óvulo-zigoto recepetor.

    De la clonación verdadera

    En animales:

    mejora de conocimientos en biomedicina

    modelos de enfermedades

    con transgénesis: producción de medicamentos

    órganos para xenotrasplantes: cerdos transgénicos con factor inhibidor de complemento humano. Este es el objetivo del grupo de PPL, cuyo artículo reciente ya hemos citado: I.A. Polejaeva et al. (2000): “Cloned pigs produced by nuclear transfer from adult somatic cells”, Nature 407: 86-90. De hecho, en dicho trabajo adelantan ya que han logrado cultivos celulares en los que el gen de la alfa-1,3-galactosil transferasa está interrumpido, por lo que no es funcional. En principio, si lograsen cerdos transgénicos a partir de estas células, podrían servir como fuentes de tejidos para xenotrasplantes a humanos, evitándose el rechazo hiperagudo del injerto. Sin embargo, la cuestión de los xenotrasplantes a partir de tejidos porcinos está en entredicho, por el riesgo de que se puedan liberar virus endógenos a la población humana. Ello se complicaría aún más con las propuestas de obtener cerdos transgénicos dotados de proteínas humanas del complemento: si bien con ello se evitaría otra de las causas de rechazo, hay que tener en cuenta que algunas de esas proteínas sirven como puertas de entrada a algunos virus humanos.

    Ganadería:

    Obtención de animales transgénicos. Recombinación homóloga para generar animales noqueados con genes inactivados y sustituidos. Producción de proteínas terapéuticas. Algunas empresas:

    PPL Therapeuthics: factor IX, a-1-antitripsina. Esta empresa ha logrado ovejas simultáneamente clónicas y transgénicas que segregan en su leche esa proteína de la que carecen los enfermos del enfisema pulmonar congénito. Hace poco han logrado expresar ese gen de forma controlada, insertándolo en un lugar predeterminado del genoma receptor, lo que si se confirma y amplía supone un gran paso para conseguir factorías vivas de sustancias útiles (K.J. McCreath, J. Howcroft, K.H.S. Campbell, A. Colman, A.E. Schnieke, A.J. Kind [2000]: “Production of gene-targeted sheep by nuclear transfer from cultured somatic cells”, Nature 405: 1066-1069).

    Genzyme Transgenics: estudios con cabras.

    Idealmente se necesita método de transferencia no quirúrgica de embriones. Rápida propagación de fenotipos probados en el sector ganadero. ¿Venta y distribución cómoda de embriones? Evitar la falta de diversidad genética, limitando el número de individuos de un mismo clon en cada rebaño.

    Intentos de salvar in extremis a especies de la extinción (p. ej, el panda gigante, un bóvido salvaje asiático llamado gaur, etc.). Incluso alguien está intentando "resucitar" especies extinguidas de las que hay material biológico conservado (alguna especie de marsupial australiano como el tigre de Tasmania, el bucardo -una subespecie de cabra montés recientemente desaparecida del Pirineo español).

    En enero de 2001 nació en los EE.UU. un gaur clónico, pero murió a los dos días a causa de una disentería.

    En octubre de 2001, se comunicó el nacimiento en Italia de un muflón clónico, a partir de células de hembras muertas de la isla de Cerdeña.

    En humanos, la clonación verdadera podría tener dos usos diferentes:

    Clonación reproductiva: tal como se describe arriba, para crear un individuo clónico. Posibles situaciones:

    Como técnica de reproducción asistida excepcional, no convencional.

    Qué riesgos podría tener?

    Datos sobre la “edad celular”

    Otros efectos (cáncer?).

    ¿Solucionar cuestiones de seguridad?

    Cuestiones de eficiencia:

    si se tuviera la eficiencia del caso Dolly, necesitaríamos 200 mujeres.

    Pero recientemente se ha visto que con el líquido de aspiración del folículo ovárico se pueden obtener muchos folículos preantrales que se pueden madurar en laboratorio hasta ovocitos maduros.

    Desarrollo de folículos ováricos humanos en ratones scid e hipogonádicos. ¿Ratones produciendo óvulos humanos?

    Cuestiones de seguridad:

    Incidencia de nacimientos muertos y abortos Según Wilmut, hay un patrón continuo de muertes durante el desarrollo embrionario y fetal, llegando a término sólo 1-2% de los embriones.

    ¿Qué edad genética tiene el clon? ¿Corresponde a la edad de la célula donante? Los datos actuales parecen indicar que la transferencia nuclear no revierte la edad genética.

    ¿Supone esto mayor peligro de acumulación de mutaciones y de envejecimiento celular? (Hay informes sobre anomalías en este sentido, por ejemplo, un acortamiento significativo de los telómeros, lo que parece un indicio de la edad celular. Hay que recordar que los telómeros restauran su longitud normal en la línea germinal, que por definición no intervino en la producción de los animales clónicos. Es posible que los efectos fisiológicos en el acortamiento de la edad de los animales clonados se reflejen tras varias generaciones). Sin embargo, otros informes sobre las terneras clónicas parecen indicar que ocurre lo contrario, un rejuvenecimiento según ciertos parámetros moleculares.

    Clonación no reproductiva: se realiza la manipulación celular como en la anterior, pero el embrión no se implanta en útero, sino que puede servir a distintos objetivos, principalmente de investigación:

    Sobre fertilidad, anticoncepción, etc.

    Desarrollo embrionario

    Obtención de células madre e inducción de diferenciación a diferentes tejidos.

    Clonación no reproductiva y células madre embrionarias 6.1 Obtención de células madre humanas

    Los informes originales de los equipos de Thomson y de Gearhart sobre el cultivo de células madre humanas. Se trata de células dotadas de inmortalidad y de pluripotencia. Posibilidad de diferenciación en distintos tipos de células y tejidos.

    El trabajo de Thomson y colegas en la Universidad de Wisconsin, financiado por Geron: aislamiento y cultivo de células madre embrionarias (ES) a partir de blastocistos procedentes de programas de FIV.

    John Gearhart, de la Johns Hopkins University School of Medicine Gearhart, en la U. John Hopkins obtuvo células madre germinales embrionarias (EG) a partir de fetos abortados. (Informes posteriores arrojan dudas sobre la conveniencia de usar estas células, ya que parece que la clonación con ellas, da origen a frecuentes anomalías del desarrollo de los animales).

    Advanced Cell Technologies (ACT) usaron una técnica similar a la de transferencia nuclear, para fusionar un óvulo enucleado de vaca con una célula somática humana: se obtuvo un embrión híbrido.

    Obtención de células madre (ES), cultivo in vitro para lograr su diferenciación en distintos tipos de células y tejidos, con fines terapéuticos: autotrasplantes, terapias celulares, etc.

    Las células ES de ratón (y quizá las humanas) son tumorigénicas: si se inyectan a un animal adulto originan teratomas y teratocarcinomas. Por lo tanto, un tema de seguridad será asegurarse que en un cultivo diferenciado a partir de ES no quedan estas células troncales, o bien disponer de métodos fiables de separación y purificación de las células diferenciadas de interés respecto de las ES.

    Queda mucho por hacer en aspectos básicos:

    ¿podemos forzar a las células madre a diferenciarse en líneas celulares concretas?

    ¿podemos lograr que todas las células de un cultivo de ES se diferencien simultáneamente en una ruta determinada?

    Estudios de marcadores (al estilo de los CD de las células inmunes) para caracterizar todas las fases intermedias de cada ruta de diferenciación

    Métodos de separar y purificar tipos celulares concretos

    Otros orígenes posibles de células madre:

    Células pluripotentes del cordón umbilical

    Células de abortos espontáneos

    ¿Hay células madre en tejidos del adulto? Hay indicios de que existen células pluripotentes en varios órganos, incluyendo el cerebro..

    ¿Se pueden desprogramar y reprogramar células somáticas?. Una posibilidad sería mediante la introducción de citoplasma de célula ES en una célula somática adulta. Se trataría de “cíbridos” por fusión de citoplastos de células madre con carioplastos de células somáticas.

    Las ES y EG, por sí mismas no pueden producir placenta, por lo que no son viables al ser transferidas al útero. Pero si se mezclan con otras células embrionarias y se encapsulan en zona pelúcida, podrían generar embriones viables que conducirían a quimeras somáticas. Incluso, en ratones se ha visto que al transferir ES a un blastocisto huésped tetraploide, las células de este mueren, sobreviviendo las ES, responsables de originar un ratón completo. Así pues, aunque las ES no pueden dar origen por sí mismas a un nuevo individuo, pueden hacerlo al ser colocadas en un ambiente celular adecuado, a saber, el que pueda generar el trofectodermo que produce la placenta.

    En resumen, de los estudios en ratón parecía deducirse que las ES no son totipotentes, pero colocadas como masa celular interna de un blastocisto huésped, pueden generar el feto, salvo la placenta.

    Ahora bien, el trabajo ya citado del grupo de Wakayama logró clones de ratón inyectando núcleos de células madre en ovocitos. Esto significa que, aunque las ES por sí mismas no sean totipotentes, su núcleo transferido puede programar la diferenciación de individuos completos (es decir, posee totipotencia nuclear). Ello abre, además, la posibilidad de generar ratones transgénicos en un solo paso, sin necesidad de pasar por la fase de quimeras somáticas. La manipulación genética de estas células madre y su ulterior clonación facilitará sobremanera la creación de clones transgénicos.

    Usos posibles de células madre humanas y Terapias celulares y autotrasplantes

    El potencial terapéutico de las ES se pondría de manifiesto sobre todo empleando ES derivadas del propio paciente, ya que no habría problemas de rechazo de injertos: estaríamos ante un autotrasplante. Una posibilidad sería tipificar muchas líneas diferentes de ES, con diferentes sistemas MHC (HLA), pero la diversidad de los haplotipos HLA es enorme, por lo que habría que eliminar o alterar algunos de los genes de histocompatibilidad.

    Pero la posibilidad teórica que ha llamado más la atención es la transferencia de núcleos somáticos del paciente a óvulos enucleados. Las desprogramación y reprogramación del núcleo seguiría en sus primeras fases la lógica a lo Dolly: se obtendría un zigoto y embrión artificial. Al llegar a la fase de blastocisto, se obtienen células de la masa celular interna (con lo que se destruye el embrión), y se cultivan en placa de Petri, obteniéndose ES con la información genética nuclear del donante. Finalmente, las ES serían tratadas para diferenciarse a distintos tipos celulares:

    Neuronas dopaminérgicas en el tratamiento de Parkinso

    Células beta del páncreas para diabéticos

    Hepatocitos para pacientes con cirrosis hepática.

    En resumen, esto es la idea de lo que se ha dado en llamar “clonación terapéutica”. En el esquema anterior queda claro que estamos ante una técnica de “doble uso”, ya que el embrión artificial obtenido, transferido a un útero preparado, podría eventualmente originar un ser humano completo, en cuyo caso estaríamos ante una clonación reproductiva verdadera.

    Los científicos del Instituto Roslin han propuesto a las autoridades británicas un proyecto consistente en obtener “bancos de células madre clonadas” por transferencia de núcleos de células pluripotentes de cordón umbilical de los recién nacidos. Cada cultivo quedaría conservado en previsión de la necesidad ulterior de diferenciarlo hacia tipos celulares requeridos para autotrasplantes del individuo donante.

    Creación de quimeras y modificación genética de la línea germinal

    Las ES son en principio la célula ideal para intentar cambios en línea germinal (véase el caso de los ratones transgénicos).Quimeras de ES manipuladas y blastómeros se implantan en úteros. Progenie quimérica, alguna de la cual será transgénica en sus células germinales. La siguiente generación sería transgénica.

    Lecturas adicionales recomendadas (en Internet):

    Aspectos de seguridad no resueltos en la tecnología de clonación

    Aspectos éticos y sociales de la clonación, incluyendo el actual debate sobre clonación "terapéutica" y uso experimental de embriones humanos

    Se recomienda la consulta del resumen del Informe sobre Clonación del Instituto de Bioética de la Fundación Ciencias de la Salud.

    Referencias

    Para un resumen histórico y conceptual, J.R. Lacadena (1998): “La clonación humana”, en Actas del 2º Congreso de bioética de América Latina y del Caribe, Santafé de Bogotá, pp. 138-165, y el cap. 1 de Comité de expertos sobre bioética y clonación (1999): Informe sobre la clonación: en las fronteras de la vida, Instituto de Bioética de la Fundación Ciencias de la Salud, Ediciones Doce Calles, Madrid. Véase igualmente National Bioethics Advisory Comisión (2000): “Ciencia y aplicación de la clonación” (parte del informe original de 1997 de la NBAC), en Clones y clones. Hechos y fantasías sobre la clonación humana (M.C. Nussbaun y C.R. Sunstein, eds.), Cátedra, Madrid, pp. 39-48.

    Bibliografía

    • Enciclopedia Encarta 98

    • Diario Clarín Digital en www.clarin.com.ar, febrero-agosto de 2000.

    • Diario La Nación en www.lanacion.com.ar, febrero-agosto de 2000.

    • Química II, Editorial Santillana.

    • Biología I, Editorial Santillana.

    • "El Genoma Humano" del Dr. Francisco Lenadro Loiácono en www.alfinal.com.

    • "Aplicaciones de la Ingeniería Genética" en www.geocities.com/genetica2000/

    • Declaración de la Asociación Médica Mundial sobre el Proyecto Genoma Humano, en www.wma.net/s/policy/17-s-1_s.html.

    • "Trabajo Práctico de Genética", de Juan Andrés Toselli, en www.monografias.com

    • "Genetic Engineering: A Costly Risk"; "The End of the World as we know it: The Environmental Costs of Genetic Engineering", en www.greenpeace.org.

    Categoría: Biología

    Sitos de internet:

    • Monografias.com

    • Aldeaeducativa.com

    • Buscador “go”.

    • Ingieneria genética