Bioquímica

Biología celular. Péptido. Configuración del carbono. Estructura helicoidal. Aminoácidos. Proteínas. Efecto Bohr. Enzimas. Células

  • Enviado por: El remitente no desea revelar su nombre
  • Idioma: castellano
  • País: España España
  • 4 páginas
publicidad
publicidad

TEST DE BIOQUÍMICA. 3º PARCIAL

  • Sea el péptido Val-Leu-Glu-Ala, ¿a la altura de qué pH migrará dicho péptido en un gel de isoelectroenfoque? Datos: pK-COOH = 2.3; PK-amino = 9.6; pK del grupo radical del glutamato = 4.5.

  • 3.4

  • 7.05

  • 5.46

  • 5.95

  • ¿Cuál será las carga del péptido anterior a un pH de 4.8?

  • -0.33

  • +0.33

  • -0.66

  • +0.66

  • La configuración del carbono  de un aminoácido de una cadena peptídica:

  • es plana, con tres orbitales híbridos sp2 y un orbital pz.

  • es tetraédrica, con cuatro orbitales híbridos sp3

  • es parcialmente plana y parcialmente tetraédrica

  • presenta configuración trans

  • En la hélice :

  • Los grupos radicales de los aminoácidos estabilizan la estructura al disponerse hacia su interior y establecer enlaces de hidrógeno con los grupos -CO-NH- de los enlaces peptídicos

  • Los grupos -CO-NH- de los enlaces peptídicos estabilizan la estructura al formar uniones de hidrógeno con moléculas del agua del medio

  • La estructura helicoidal se estabiliza gracias a la formación de puentes disulfuro entre cisteínas, que, al tener carácter covalente, dan una gran estabilidad estructural

  • Los grupos -CO-NH- de un enlace peptídico forman enlaces de hidrógeno con otros grupos similares de otros enlaces peptídicos de un modo fijo, lo que estabiliza la estructura y le proporciona su aspecto helicoidal

  • La mioglobina y la hemoglobina son dos proteínas con capacidad para unir oxígeno que desempeñan funciones diferentes en el organismo. Señala la respuesta correcta:

  • Ambas proteínas presentan el efecto Bohr o variación de su afinidad por el oxígeno en función del pH y los niveles de CO2

  • El índice de Hill para la mioglobina es superior al de la hemoglobina

  • La Po2 de semisaturación o P50 es mayor para la hemoglobina que para la mioglobina

  • Ambas proteínas contienen estructuras de barril 

  • Sea la reacción A + B P catalizada enzimáticamente, la velocidad de dicha reacción puede expresarse como  = d [P] / dt = K [A] [B]. Si analizamos la reacción en condiciones en las que [A]0 >>> [B]0 , la cinética de esta reacción a tiempos cortos será:

  • de orden 2

  • de orden 0

  • de pseudoprimer orden

  • de orden 1.5

  • Al determinar la velocidad inicial de una reacción catalizada enzimáticamente en presencia o ausencia de un inhibidor, se obtuvieron los resultados:

  • [S] mM

    V (mol/min)

    Sin inhibidor

    V (mol/min)

    Con inhibidor

    0.1

    0.04

    0.01

    0.5

    0.99

    0.25

    1

    3.84

    0.99

    5

    50

    20

    10

    80

    50

    20

    94.11

    80

    50

    99

    96.15

    Se trata de una enzima:

  • Michaeliana + inhibidor competitivo

  • Michaeliana + inhibidor no competitivo

  • Alostérica + modulador alostérico V (inhibidor)

  • Alostérica + modulador alostérico K (inhibidor)

  • Entre los mecanismos que se conocen que permiten modular la actividad de una enzima en la célula, cabe mencionar: la variación de la cantidad de enzima; la interconversión covalente; la modulación alostérica. Cada uno de estos mecanismos permite la regulación de la actividad enzimática de un modo agudo (rápido) o a más largo plazo. Ordena los tres mecanismos desde el más agudo al más duradero:

  • 3 - 2 - 1

  • 1 - 2 - 3

  • 2 - 3 - 1

  • 3 - 1 - 2

  • Señala la respuesta NO correcta de entre las siguientes, mencionadas en relación a la estructura de un DNA eucariota:

  • La suma de los nucleótidos de purina es igual a la de los de pirimidina

  • Entre G y C enfrentados se establecen dos puentes de H

  • La doble hélice dextrógira es la conformación más estable

  • La interacciones hidrofóbicas estabilizan la estructura

  • A diferencia del RNAm de eucariotas, el de procariotas:

  • contiene un poliA en 3'

  • es policistrónico

  • contiene 7 metil C en 5'

  • contiene intrones

  • La proteína nusA de procariotas participa:

  • en el proceso de traducción

  • se une a la RNA pol

  • provoca la terminación de la transcripción

  • reconoce secuencias terminadoras de traducción

  • La DNA pol I:

  • participa exclusivamente en la elongación de la cadena replicativa

  • presenta mayor procesividad que las DNA pol II y III

  • no presenta actividad exonucleasa 3'- 5'

  • tiene actividad RNAasa

  • La transcripción-traducción acoplada de un fragmento de DNA bicatenario que incluye el origen de transcripción de un gen de secuencia

  • 5' TCCTCCAAAATGATTATCATAATGATGCTTCTCCTGCTATTTTTCTT 3'

    3' AGGAGGTTTTACTAATAGTATTACTACGAAGAGGACGATAAAAAGAA 5'

    produciría el péptido:

  • Met - Ile3 - Met2 - Leu4 - Phe2

  • Met - Ile3 - Met2 - Leu4 - Phe4

  • Met - Ile3 - Leu2 - Glu

  • Met - Ile3 - Leu - Glu2 - Leu2

  • En relación a la eritromicina:

  • Inhibe el inicio de la traducción de genes eucariotas

  • Provoca la terminación prematura de la cadena polipeptídica en genes eucariotas y procariotas

  • Es un inhibidor de elongación traduccional

  • Todas las opciones anteriores son falsas

  • ¿Qué efecto tendría sobre la expresión de los genes implicados en la utilización de lactosa en E.coli una mutación que inactivara el producto del gen Lac I?:

  • La represión de la transcripción de estos genes

  • La expresión de estos genes en ausencia de lactosa

  • Los genes se expresarían sólo en presencia de lactosa

  • No tendría ningún efecto sobre la regulación de este proceso

  • En la reacción en cadena de la polimerasa, PCR, se genera como producto final:

  • Moléculas de RNA bicatenario

  • Moléculas de DNA bicatenario

  • Moléculas de RNA monocatenario

  • Moléculas de DNA monocatenario